... Technician Training in collaboration with Punjab Vocational Training Council(PVTC) Training course duration 30 days Practical training covered at Large Animal SlaughterHouse, Lahore. Training ... general.BaluchistanNWFPPunjabSindhLahoreDRDF-USAID Project OfficeChechavatniZoneSarsabzTraining Farmfor farmerSukhekiTraining Farmfor FarmerBurj AttariAI TechniciansTraining FarmMultanAITechnicianTrainingFarmPeerMahalZoneProject ... Coverage MapKhanewal(Farmertrainings)Kamalia(Farmertraining)Milk collection infrastructure Contd.’Chilling set-up ata local farm at GOJRAThank youDairy Project – DRDF-USAID• A. I training...
... purpose and format. Besides this, they also involve the intuitive as well as the rational intellectual faculties ina recursive rather than a linear way: students are forced to examine different aspects ... conventions and constraints inthe target culture: the key elements are a clearly defined content and the adequate rhetorical schemata . In all cases, the situation has to be made clear to the students, ... depending on the task and its complexity, so that along the drafting -writing- revision procedure, listening, speaking, reading and writing will overlap and intertwine, involving thinking, talking,...
... TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTCTTGAACACY. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a GSP-FwdNM_200751 TGGGGAGGACTTTTATGCTGTRPE6 5a ... expressing RPE65cwas incubated with liposomes containing atRE, and the generated retinoids from the reaction were analyzed byHPLC. Inthe absence of a metal chelator, RPE65c cat-alyzed the production...
... have an aspartate as the catalytic apparatus.However, for chymotrypsin-type serine proteases, the replacement of this aspartate with an alanine diminishesprotease activity 104-fold [24]. Therefore, ... by the Trp169–His210 stacking, suggesting thatAPI has a catalytic quadruple apparatus, composed ofSer194, His57, Asp113 and His210, rather than a catalytictriad.ACKNOWLEDGEMENTWe are grateful ... 2002side-chain at residue 210 is dispensable, as shown by the factthat H21 0A and H210S are as active as native API withVLK-MCA as a substrate (Table 1). This means thatTrp169 does not play a role as...
... management, and sustainability ofoutcomes. Project performance ratings from the AMBs are stored ina centralized automated databasethat – along with project financial data – will be used for annual agency ... capita, infantmortality rates, school enrolment rates, etc). Atthe qualitative extreme are data that can be captured only bydescriptive narrative. Inthe middle are data for which the frequency ... performance then becomes a process of gathering data at periodic intervals and examining actualprogress achieved vis-à-vis the target.Targets may be useful in several respects. They help bring the...
... defences (b) Ciliated columnar epitheliumIgAInvadingbacteriaMacrophageCiliaGelphaseMucusSolphaseEpithelialcellBasementmembraneLumenEpitheliumLamina propriaSubmucosalglandSecretorycomponentGobletcell(c) ... lowerPosterior aspect(c) Bohr equation for measuringdead spaceAnatomical dead space,Volume = VDRespiratory zone:Alveolar CO2 fraction = F A CO2End of inspiration End of expirationEnd-tidal =alveolar ... thisregionLowIncreasedLowUnchangedNormalUnchanged(b) Variation of ventilation, V A , perfusion, Q and ventilation–perfusion ratio, V A /Q with vertical height in the upright lungV A QR = The respiratory gas exchange ratio...
... express aromatase (P450arom) andactively synthesize estradiol ata rate much greater thanthat seen inthe adult Sertoli cell [31,32,38,69–72]. Cur-rently, a growing body of evidence indicates that ... is mediated by a decrease in the expression of NHE3 mRNA and protein and also decreases in carbonic anhydrase II (CAII) and aquaporin I (AQP-1) pro-teins. There is also an increase in cystic ... Bourguiba S, Chocat A andCarreau S: Expression of aromatase in human ejaculated sper-matozoa: a putative marker of motility Mol Hum Reprod 2003,9:117-124.81. Levallet J and Carreau S: In vitro...
... 1000) as the primary antibody. Antibody binding was visualizedusing alkaline phosphate-conjugated goat anti-rabbit IgGand an alkaline phosphate substrate kit (Bio-Rad).Expression and purification ... proHP8Xaand the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan-dards are indicated on the left. (B) The catalytic activity of activated ... lepidopteraninsect, suggesting that a cytokine-activated Toll path-way is an ancient feature of innate immunity in insects.Although the families of extracellular moleculesinvolved in this pathway are conserved...
... fromsteady-state kinetics that we have obtained ina previousstudy [13]. There we showed that the catalytic mechanismimplied an intermediate complex incompatible with bindingof the electron donor and allowing ... experimentaldata and the plot obtained by fitting. The traces obtained are comparable to these obtained byZhao et al. [15]. These authors found four phases in the reduction of the cytochrome by menadiol, ... cytoplasmic side, was associated with the binding site forubiquinols. This conclusion agrees with structural data thatindicate a cavity containing two distinct regions directlyadjacent to the...
... C1 and C2 domains appeared tobe joined by a ‘linker’ sequence. Also boxedare the transmembrane domain and the serine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea ... molecules in the other major protostomal clade, the lophotrochozoa.An increasing amount of comparative data fromecdysozoans as well as from vertebrates suggeststhat many of the proteins involved in ... boxed.Also boxed are the transmembrane domain, the ATP binding site, the L45 loop and the serine ⁄ threonine kinase domain. (B) The implied amino acid sequence of Cg-TGFbsfR2 contains a leader...
... calibration curves was used to measure flow rate of the wastewater generated from paper machines. Wastewater generation from other units were measured by using bucket and stop watch. Wastewater ... Black LiquorWashing WastewaterPAPER MAKING Beating WastewaterDilutionPaper Machine WastewaterFinishing Waste PaperPAPERH2O, Steam, ElectricityBoiler Flue GasUtilities Boiler Ash (Coal ... sugar cane bagasse as raw material. Initial investigation of environmental status of the mill included water, air and noise pollution but the major task focused on wastewater. The study...
... suggestingthat GBE50 prevented the harm caused by an HFD. In addition, we found no significant alterations in the levels of alanine aminotransferase, aspartate amino-transferase or creatinine kinase ... regulation, the blocked green lines indicate negativeregulation, and the dashed lines indicate indirect inhibition. The black lines indicate substance conversion or transportation flow. The dashed ... that fatty acid bio-synthesis was repressed and metabolism was enhanced in animals exposed to an HFD with GBE50. Genesinvolved in fatty acid biosynthesis, such as Acacb,Acbd6 (acyl-CoA-binding...
... standards. From the summary above it is clear that Liberia’s national law is inchoate, discriminatory and anachronistic atthe very least, as well as being in breach of international human ... customary land, and on the other hand acknowledged that they did not carry out the necessary research and consultations to find out whether that was the case, and are clear that they have made ... development ambitions – including via legislative reform of land and resource sectors – ina way that maintains compliance with its international law commitments, and for Sime Darby to maintain their...
... range for thermophilic F1-ATPase activity.ATP hydrolysis assayATP hydrolysis was measured using an ATP-regeneratingsystem as a decrease in A 340of NADH at 25 °C. The assaymixture contained ... indicated concentrations of MgATP wereaddedat0s.(B)TimecourseofMgATPbindingintheabsenceofPi.MgATP was added as in (A) at 0 s. (C) Dependence of the timeconstant of MgATP binding to the a (W463F)3b(E190Q/Y341W)3c ... Boyer [42]. At higher ATP concentrations, the effect of Pion the ATP-binding rate was not observed. At high ATP concentrations,however, ATP binding is inherently fast, and the apparentabsence...
... BankingAssociation. The Democratic Party platform called for a national guarantee of personaldeposits, following what several States had already done starting in 1907, and endorsedpostal savings only as ... is a vector of variables including:r = the interest advantage of postal savings, represented as 2% less the average rate paidon time deposits at private institutions. Data for the latter are ... between the rates paid on postal versus ordinary-bank deposits, since separatedata are not available for the two classes of private bank) and the confidence variable (the number of bank failures as...