writing in the margins six strategies at a glance

... Technician Training in collaboration with Punjab Vocational Training Council (PVTC)  Training course duration 30 days  Practical training covered at Large Animal Slaughter House, Lahore.  Training ... general. Baluchistan NWFP Punjab Sindh Lahore DRDF-USAID Project Office Chechavatni Zone Sarsabz Training Farm for farmer Sukheki Training Farm for Farmer Burj Attari AI Technicians Training Farm Multan AI Technician Training Farm Peer Mahal Zone Project ... Coverage Map Khanewal (Farmer trainings) Kamalia (Farmer training) Milk collection infrastructure Contd.’ Chilling set-up at a local farm at GOJRA Thank you Dairy Project – DRDF-USAID • A. I training...

Ngày tải lên: 24/03/2014, 04:20

... purpose and format. Besides this, they also involve the intuitive as well as the rational intellectual faculties in a recursive rather than a linear way: students are forced to examine different aspects ... conventions and constraints in the target culture: the key elements are a clearly defined content and the adequate rhetorical schemata . In all cases, the situation has to be made clear to the students, ... depending on the task and its complexity, so that along the drafting -writing- revision procedure, listening, speaking, reading and writing will overlap and intertwine, involving thinking, talking,...

Ngày tải lên: 06/09/2013, 05:10

... TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi ... GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a GSP-Fwd NM_200751 TGGGGAGGACTTTTATGCTGT RPE6 5a ... expressing RPE65c was incubated with liposomes containing atRE, and the generated retinoids from the reaction were analyzed by HPLC. In the absence of a metal chelator, RPE65c cat- alyzed the production...

Ngày tải lên: 14/02/2014, 14:20

... have an aspartate as the catalytic apparatus. However, for chymotrypsin-type serine proteases, the replacement of this aspartate with an alanine diminishes protease activity 10 4 -fold [24]. Therefore, ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad. ACKNOWLEDGEMENT We are grateful ... 2002 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1). This means that Trp169 does not play a role as...

Ngày tải lên: 21/02/2014, 03:20

... management, and sustainability of outcomes. Project performance ratings from the AMBs are stored in a centralized automated database that – along with project financial data – will be used for annual agency ... capita, infant mortality rates, school enrolment rates, etc). At the qualitative extreme are data that can be captured only by descriptive narrative. In the middle are data for which the frequency ... performance then becomes a process of gathering data at periodic intervals and examining actual progress achieved vis-à-vis the target. Targets may be useful in several respects. They help bring the...

Ngày tải lên: 21/02/2014, 11:20

... defences (b) Ciliated columnar epithelium IgA Invading bacteria Macrophage Cilia Gel phase Mucus Sol phase Epithelial cell Basement membrane LumenEpitheliumLamina propria Submucosal gland Secretory component Goblet cell (c) ... lower Posterior aspect (c) Bohr equation for measuring dead space Anatomical dead space, Volume = V D Respiratory zone: Alveolar CO 2 fraction = F A CO 2 End of inspiration End of expiration End-tidal = alveolar ... this region Low Increased Low Unchanged Normal Unchanged (b) Variation of ventilation, V A , perfusion, Q and ventilation–perfusion ratio, V A /Q with vertical height in the upright lung V A Q R = The respiratory gas exchange ratio...

Ngày tải lên: 05/03/2014, 11:21

... express aromatase (P450arom) and actively synthesize estradiol at a rate much greater than that seen in the adult Sertoli cell [31,32,38,69–72]. Cur- rently, a growing body of evidence indicates that ... is mediated by a decrease in the expression of NHE3 mRNA and protein and also decreases in carbonic anhydrase II (CAII) and aquaporin I (AQP-1) pro- teins. There is also an increase in cystic ... Bourguiba S, Chocat A and Carreau S: Expression of aromatase in human ejaculated sper- matozoa: a putative marker of motility Mol Hum Reprod 2003, 9:117-124. 81. Levallet J and Carreau S: In vitro...

Ngày tải lên: 05/03/2014, 17:20

... 1000) as the primary antibody. Antibody binding was visualized using alkaline phosphate-conjugated goat anti-rabbit IgG and an alkaline phosphate substrate kit (Bio-Rad). Expression and purification ... proHP8 Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan- dards are indicated on the left. (B) The catalytic activity of activated ... lepidopteran insect, suggesting that a cytokine-activated Toll path- way is an ancient feature of innate immunity in insects. Although the families of extracellular molecules involved in this pathway are conserved...

Ngày tải lên: 06/03/2014, 09:22

... from steady-state kinetics that we have obtained in a previous study [13]. There we showed that the catalytic mechanism implied an intermediate complex incompatible with binding of the electron donor and allowing ... experimental data and the plot obtained by fitting. The traces obtained are comparable to these obtained by Zhao et al. [15]. These authors found four phases in the reduction of the cytochrome by menadiol, ... cytoplasmic side, was associated with the binding site for ubiquinols. This conclusion agrees with structural data that indicate a cavity containing two distinct regions directly adjacent to the...

Ngày tải lên: 07/03/2014, 15:20

... C1 and C2 domains appeared to be joined by a ‘linker’ sequence. Also boxed are the transmembrane domain and the serine ⁄ threonine kinase domain. A. Herpin et al. BMP/activin pathway in Crassostrea ... molecules in the other major protostomal clade, the lophotrochozoa. An increasing amount of comparative data from ecdysozoans as well as from vertebrates suggests that many of the proteins involved in ... boxed. Also boxed are the transmembrane domain, the ATP binding site, the L45 loop and the serine ⁄ threonine kinase domain. (B) The implied amino acid sequence of Cg- TGFbsfR2 contains a leader...

Ngày tải lên: 07/03/2014, 21:20

... calibration curves was used to measure flow rate of the wastewater generated from paper machines. Wastewater generation from other units were measured by using bucket and stop watch. Wastewater ... Black Liquor Washing Wastewater PAPER MAKING Beating Wastewater Dilution Paper Machine Wastewater Finishing Waste Paper PAPER H 2 O, Steam, Electricity Boiler Flue Gas Utilities Boiler Ash (Coal ... sugar cane bagasse as raw material. Initial investigation of environmental status of the mill included water, air and noise pollution but the major task focused on wastewater. The study...

Ngày tải lên: 09/03/2014, 01:20

... suggesting that GBE50 prevented the harm caused by an HFD. In addition, we found no significant alterations in the levels of alanine aminotransferase, aspartate amino- transferase or creatinine kinase ... regulation, the blocked green lines indicate negative regulation, and the dashed lines indicate indirect inhibition. The black lines indicate substance conversion or transportation flow. The dashed ... that fatty acid bio- synthesis was repressed and metabolism was enhanced in animals exposed to an HFD with GBE50. Genes involved in fatty acid biosynthesis, such as Acacb, Acbd6 (acyl-CoA-binding...

Ngày tải lên: 16/03/2014, 04:20

... standards. From the summary above it is clear that Liberia’s national law is inchoate, discriminatory and anachronistic at the very least, as well as being in breach of international human ... customary land, and on the other hand acknowledged that they did not carry out the necessary research and consultations to find out whether that was the case, and are clear that they have made ... development ambitions – including via legislative reform of land and resource sectors – in a way that maintains compliance with its international law commitments, and for Sime Darby to maintain their...

Ngày tải lên: 17/03/2014, 11:20

... range for thermophilic F 1 -ATPase activity. ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A 340 of NADH at 25 °C. The assay mixture contained ... indicated concentrations of MgATP were addedat0s.(B)TimecourseofMgATPbindingintheabsenceofP i . MgATP was added as in (A) at 0 s. (C) Dependence of the time constant of MgATP binding to the a (W463F)3 b (E190Q/Y341W)3 c ... Boyer [42]. At higher ATP concentrations, the effect of P i on the ATP- binding rate was not observed. At high ATP concentrations, however, ATP binding is inherently fast, and the apparent absence...

Ngày tải lên: 24/03/2014, 00:21

... Banking Association. The Democratic Party platform called for a national guarantee of personal deposits, following what several States had already done starting in 1907, and endorsed postal savings only as ... is a vector of variables including: r = the interest advantage of postal savings, represented as 2% less the average rate paid on time deposits at private institutions. Data for the latter are ... between the rates paid on postal versus ordinary-bank deposits, since separate data are not available for the two classes of private bank) and the confidence variable (the number of bank failures as...

Ngày tải lên: 29/03/2014, 07:20

Ngày tải lên: 07/04/2014, 11:11