... created in this lab. Procedures In this lab, the student will create and execute a Visual Basic Script and place it the start menu. Step 1: Writing the Script 1. Open up Notepad. Go to Start ... 8.5.6 Copyright 2002, Cisco Systems, Inc. Lab 8.5.6: Writing a Script in Windows 2000 Estimated Time: 30 Minutes Objective The objective of this lab is to learn how to write a script ... double-click on it. 2. Do not type anything in the box and click OK. Notice what message is displayed and how it corresponds to the entry in the text of the script. 3. Click OK. 4. Double-click...
Ngày tải lên: 11/12/2013, 15:15
... often an opinion piece that analyzes a particular topic or book, while a research paper involves analyzing raw data and different facts and statistics from a variety of sources. Once you have collected ... International and Pan-American Copyright Conventions. Published in the United States by LearningExpress, LLC, New York. Library of Congress Cataloging -in- Publication Data: Stark, Rachael. Research and writing ... types of findings and data have you and your agency collected from examining the local water? – INTERVIEWING PRIMARY SOURCES – 36 RESEARCH & WRITING SKILLS SUCCESS IN 20 MINUTES A DAY 14. The...
Ngày tải lên: 18/03/2013, 01:45
Writing a Simple Program in an Assembly Language
... CPU can execute machine instructions only. No matter in which language a program is written, it must be converted into machine instructions in the end. Since machine instructions are collections ... symbols: Available characters are A to Z, a to z, 0 to 9, _ and $ Upper and lower cases are handled as different characters The first character must not be a numeric value The same name as a CPU ... words, you cannot determine what must be included in the RAM data area. In the RAM, you can only reserve an area for writing data temporarily. On the contrary, the .DATA control instruction is...
Ngày tải lên: 29/09/2013, 11:20
Writing device drivers in Linux: A brief tutorial
... (which is a kernel) manages the machine’s hardware in a simple and efficient manner, offering the user a simple and uniform programming interface. In the same way, the kernel, and in particular its ... functions Load module Open device Read device Write device Close device Remove module Table 1. Device driver events and their associated interfacing functions in kernel space and user space. Interfacing ... illustrates these concepts. This table will also be filled as the concepts are introduced. Writing device drivers in Linux: A brief tutorial Interfacing functions between kernel space and the hardware...
Ngày tải lên: 23/10/2013, 22:15
Tài liệu Writing device drivers in Linux: A brief tutorial docx
... their associated interfacing functions in kernel space and user space. Interfacing functions between kernel space and the hardware device There are also functions in kernel space which control ... kernel) manages the machine’s hardware in a simple and efficient manner, offering the user a simple and uniform programming interface. In the same way, the kernel, and in particular its device drivers, ... in Linux: A brief tutorial Final application: flashing lights 18 Fortunately enough, PCs still come with a built -in parallel port, despite the actual trend of changing everything inside a PC...
Ngày tải lên: 13/12/2013, 11:15
Tài liệu Writing a Script File in Linux pptx
... perform a backup. Instead of typing all these different commands individually each time, a script file can be written to execute all of them with one command. Procedures Basic knowledge of the command ... 2002, Cisco Systems, Inc. Lab 10.4.10: Writing a Script File in Linux Estimated Time: 25 minutes Objective Upon completion of this lab, the student will be able to create a script file and ... directory and files back? Y/N ________________________ 3 - 4 IT Essentials II v2.0 - Lab 10.4.10 Copyright 2002, Cisco Systems, Inc. 2. Create a vi script that will automate the backup process....
Ngày tải lên: 18/01/2014, 05:20
Tài liệu Linux Kernel in a Nutshell docx
... interactive kernel configuration tools: a terminal-based one called menuconfig, a GTK+-based graphical one called gconfig, and a QT- based graphical one called xconfig. www.it-ebooks.info 6 | Chapter ... Source Chapter 4, Configuring and Building Chapter 5, Installing and Booting from a Kernel Chapter 6, Upgrading a Kernel www.it-ebooks.info LINUX KERNEL IN A NUTSHELL www.it-ebooks.info 3 Chapter ... script that can be used to install the kernel automatically instead of having to type the previous commands all the time: #!/bin/sh # # installs a kernel # make modules_install # find out what kernel...
Ngày tải lên: 17/02/2014, 23:20
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... Drosophila genomic DNA using primers 5Â-ATAAGCTTGCTTT AAAATCCACCCCACG-3Â and 5Â-TCGGATCCC AGTGCCCACTTATTCGAAAAG-3Â. HindIIIBamHI digested PCR product was cloned into the pBlueScript SK- vector and ... ollowing pair of primers: 5Â-CAGGATCCATGACACTTCCTAGTGCG GCTCGC-3Â and 5Â-CCAAGCTTTTATTGCTGATTAT TGGGATTCATTTGACCA-3Â (the gene encoding the Drosophila CK2 a subunit does not contain introns in ... whole CK 2a ORF region was amplified from Drosophila genomic DNA using the following pair of primers: 5Â-CAGAATTCA TGACACTTCCTAGTGCGGCTCGC-3Â and 5 Â-CTG GATCCTTATTGCTGATTATTGGGATTCATTTGA CCA-3Â. EcoRIBamHI...
Ngày tải lên: 21/02/2014, 15:20
A Complete Guide to Programming in C++ doc
... literal 5.19 0.519E1 0.0519e2 519.OE-2 12. 12.0 .12E+2 12e0 0.75 .75 7.5e-1 75E-2 0.00004 0.4e-4 .4E-4 4E-5 Constant Character Constant Value (ASCII code decimal) Capital A Lowercase a Blank Dot Digit 0 Terminating null character 65 97 32 46 48 0 &apos ;A& apos; &apos ;a& apos; ' ' '.' '0' '\0' ... by code 65, for example. The character set defines which code represents a certain character. When displaying characters on screen, the applicable character codes are transmitted and the “receiver,” ... properties and capacities that are important for account management. OOP objects combine data (properties) and functions (capacities). A class defines a certain object type by defining both the...
Ngày tải lên: 05/03/2014, 17:20
MASTERS OF WATERCOLOUR PAINTING WITH INTRODUCTION BY H. M. CUNDALL, I.S.O., F.S.A.EDITED BY GEOFFREY HOLME LONDON: THE STUDIO, LTD., 44 LEICESTER SQUARE, W.C.2 1922-1923.CONTENTSPAGE Introduction by H. M. Cundall, I.S.O., F.S.A. ILLUSTRATIONS IN COL docx
... number of drawings, which are remarkable for their accuracy and delicate treatment, such as the Village Scene (Plate III). 3 Thomas Hearne was a contemporary with Rooker. It was a custom at this ... prohibition against accepting unsolicited donations from donors in such states who approach us with offers to donate. International donations are gratefully accepted, but we cannot make any statements ... scenes, failed to appreciate such paintings as the Classical Scene (Plate XIII), executed with such freedom and vigour. It was recently exhibited at the Special Exhibition of Cotman’s Paintings...
Ngày tải lên: 06/03/2014, 13:20
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... (5Â-GAATTCatgaaggttctcctccactg-3Â) and rO-MACS-XhoI-D (5Â-CTCGAGtgcccgtccccactcctggt-3Â) for o-macs; EcoRI-mMACS1-U (5Â-GAATTCatgcagtggc tgaagagttt-3Â) and mMACS1-XbaI-D (5Â-TCTAGAtagct gaccaaactccttg-3Â)forMACS1, and cloned into ... OCAM 5Â-gagaagtggtgtcccctcaa-3Â (forward), 5Â-cctccatcatcttgctt ggt-3Â (reverse); NCAM 5Â-cttcctgtgtcaagtggcag-3Â (for- ward), 5Â-gttggcagtggcattcacga-3Â (reverse); and NeuroD 5Â-aagacgcatgaaggccaatg-3Â (forward), ... 5Â-aggt gttttcagcgcctagc-3Â (forward), 5Â-caccattactctgtctcctc-3Â (re- verse); KS 5Â-ccttctggggcactgagatg-3Â (forward), 5Â-agaac gcatgcagccgaggg-3Â (reverse); KS2 5Â-tggtagctacctggga agcc-3Â (forward), 5Â-gaagcaccagactcattctg-3Â...
Ngày tải lên: 08/03/2014, 02:20
WRITING SKILLS SUCCESS IN 20 MINUTES A DAY docx
... abcd 7. abcd 8. abcd 9. abcd 10. abcd 11. abcd 12. abcd 13. abcd 14. abcd 15. abcd 16. abcd 17. abcd 18. abcd 19. abcd 20. abcd 21. abcd 22. abcd 23. abcd 24. abcd 25. abcd 26. abcd 27. abcd 28. abcd 29. ... abcd 29. abcd 30. abcd 31. abcd 32. abcd 33. abcd 34. abcd 35. abcd 36. abcd 37. abcd 38. abcd 39. abcd 40. abcd 41. abcd 42. abcd 43. abcd 44. abcd 45. abcd 46. abcd 47. abcd 48. abcd 49. abcd 50. abcd ... Mexican Restaurant Practice Choose the correctly capitalized version of each of the following pairs. 25. a. Digging the Canal through Panama took many years. b. Digging the canal through Panama...
Ngày tải lên: 16/03/2014, 23:20
Investigating Writing Sub-skills in Testing English as a Foreign Language: A Structural Equation Modeling Study doc
... practical than a very analytical, pedantic approach. Also, Mickan and Slater (2003) took issue with the analytic scale since, as they claimed, “Highlighting vocabulary and sentence structure ... Has fully operational command of the language with only occasional unsystematic inaccuracies and inappropriacies. Misunderstandings may occur in unfamiliar situations. Handles complex detailed ... March 2010 Aryadoust 3 which comprise such components as lexis, syntax, spelling, and communicating ideas in assessing writing and yet expand on the list in analytic writing. Writing researchers...
Ngày tải lên: 19/03/2014, 07:20
English Solutions for Engineering and Sciences Research Writing: A guide for English learners to publish in international journals ppt
... You, Director of the Center for Teaching and Learning, for recognizing that an innovate writing lab approach was required to help faculty and graduate students with advanced English writing skills. ... Research Writing: A guide for English learners to publish in international journals Director, English Writing Lab Center for Teaching and Learning and College of Engineering Hanyang ... a more general approach to science and engineering writing was taken in this book. Future revisions will focus on single fields or research approaches rather than disciplines like engineering...
Ngày tải lên: 19/03/2014, 08:20
Kirch prinz, prinz a complete guide to programming in c++
... type. ᮀ Character Constants A character constant is a character enclosed in single quotes. Character constants take the type char. EXAMPLE: &apos ;A& apos; // Type: char The numerical value is the character ... literal 5.19 0.519E1 0.0519e2 519.OE-2 12. 12.0 .12E+2 12e0 0.75 .75 7.5e-1 75E-2 0.00004 0.4e-4 .4E-4 4E-5 Constant Character Constant Value (ASCII code decimal) Capital A Lowercase a Blank Dot Digit 0 Terminating null character 65 97 32 46 48 0 &apos ;A& apos; &apos ;a& apos; ' ' '.' '0' '\0' ... codes. The C+ + language does not stipulate any particular characters set, although in gen- eral a character set that contains the ASCII code (American Standard Code for Informa- tion Interchange)...
Ngày tải lên: 19/03/2014, 14:10
Naveen toppo, hrishikesh dewan pointers in c a hands on approach 2013
Ngày tải lên: 19/03/2014, 14:11
Báo cáo " Student writing process, perceptions, problems, and strategies in writing academic essays in a second language: A case study " docx
Ngày tải lên: 22/03/2014, 10:20