working with billboards to add a water tower

... Jonathan Stark and David Kaneda have done a lot to enhance jQTouch over the last 18 months Kudos to both of them Adding Animation Animation is a big deal in iPhone applications You can add fancy dissolves, ... the floating bar animation will take to place the bar on the screen when you load the page After the JavaScript you will want to add a custom CSS class that will control how the toolbar will ... custom code, just plain HTML (jQTouch styles and formatting take care of the rest) Here you can see that a standard HTML form has been added to the page The one change to a standard form that...

Ngày tải lên: 29/04/2014, 15:25

... hda1, hda2, and hda3 are all physical volumes We'll initialize hda3 as a physical volume: root@lappy:~# pvcreate /dev/hda3 If you wanted to combine several disks, or partitions you could the same ... that we have a volume group (called skx-vol) we can actually start using it Working with logical volumes What we really want to is create logical volumes which we can mount and actually use In ... might be useful to take a look at them with the pvdisplay command: root@lappy:~# pvdisplay - Physical volume PV Name /dev/hda3 VG Name skx-vol PV Size 28.88 GB / not usable Allocatable yes PE Size...

Ngày tải lên: 18/09/2012, 10:12

... environment contamination by extraneous substances are preventive measures that can be applied on a larger part of the area of endangered forest ecosystems According to Janeček (1992), the measures consist ... always cause a change in power and material consumption and thus a change in heterogeneous substance emissions proportional to the changed performance, which is in general the function of material ... usually leads to a certain oversize; – Dimensional changes in stages (material flows processed by the logging and transport systems), resulting from the changed performance of the system, not always...

Ngày tải lên: 07/08/2014, 10:21

... kidney (assessed on the basis of blood urea nitrogen and creatinine levels) or liver (assessed by glutamate oxaloacetate transaminase, glutamate pyruvate transaminase, alkaline phosphatase and g-glutamyl ... exercise was noted Case is a 30-year-old Japanese man who was transferred to the emergency department with diabetic ketoacidosis and was initially diagnosed with type diabetes three years prior to this ... Kaufman KD, Amatruda JM, Engel SS, Katz L: Efficacy and safety of sitagliptin when added to insulin therapy in patients with type diabetes Diabetes Obes Metab 2010, 12:167-177 Nagakura T, Yasuda...

Ngày tải lên: 11/08/2014, 00:23

... working alliance in the online and the face -to- face group Patients and therapists were asked to evaluate the quality of the working alliance at post-treatment; patients additionally completed the Working ... B.W and B.P carried out analysis and interpretation of data, and drafted the manuscript All authors read and approved the final manuscript Acknowledgements The authors would like to thank Andrea ... the working alliance and depression As participants were first contacted online and later allocated at random to the online or the face -to- face group, all measures were administered as self-rated...

Ngày tải lên: 11/08/2014, 16:21

... world markets There Stopping globalization is about as easy as are articulate voices in stopping a charging elephant with a feather opposition to the unfair, unbalanced aspects of globalization and ... efforts toward international understanding should stop rather than intensify after September 11 But stopping globalization is about as easy as stopping a charging elephant with a feather Understandably, ... amused, • Food to see an elderly Asian man • Population in the Hong Kong airport • Music loudly clear his throat • Clothing and, with a “graaaak” and • Art and literature a “patooey,” eject a...

Ngày tải lên: 24/08/2014, 15:15

... Asian Morita S[29] 1998 Japan Asian van Lieshout EM[30] 1999 The Netherlands Caucasian Tan W&[31] 2000 China Asian Lee JM[22] 2000 China(Taiwan) Asian Casson AG[21] 2003 Canada Caucasian Roth MJ[32] ... MJ[32] 2004 China Asian Casson AG[20] 2006 Canada Caucasian Cai L[25] 2006 China Asian Murphy SJ[33] 2007 Irish Caucasian Canova C[19] 2009 European Caucasian SNP site Sample size HWE MAF Genotypic ... activation, the p53 protein accumulates rapidly through posttranscriptional mechanisms and is also activated as a transcriptional factor, which leads to cell cycle arrest for DNA repair or apoptotic...

Ngày tải lên: 25/10/2012, 11:40

... conventional parameter apparatus such as temperature, pH and conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, ... of mathematical models Mathematical Models to describe wastewater treatment process develop very fast these years The task group of IAWQ (International Association of Water Quality) first began ... instruments in Qinghe WWTP Locatio Apparatus for Apparatus for water quality analysis n* conventional parameters Flowmeter/ Liquid Multi-function water quality analysis apparatus (for pH, T, level BOD5,...

Ngày tải lên: 05/09/2013, 09:08

... reluctant to ask you questions or to ask you to repeat what you just said You need to pay attention to body language to see if you’re being understood A wrinkled forehead or nose, or a blank stare ... film, she could have asked, “What was it about? What was useful about it?” and so on Then Jack would have had to think carefully and explain it to her in detail 132 WORKING WITH A STUDY BUDDY GROUND ... You might need to encourage your partner to speak more Perhaps you need to ask your partner to read something aloud to you Maybe it would help to hear a description of what you see And in turn,...

Ngày tải lên: 02/11/2013, 18:20

... further clarified by several researchers For example, Bernhardt and Kamil (1975) assume that “reading performance in a second language is largely shared with reading ability in a first language” (p ... the reason the students can not read adequately in English is that they cannot read adequately in the native language The interaction between first language and second language reading ability ... and writing In teaching and learning English as a foreign language in Vietnam, reading has always received a great deal of attention This is understandable, English is learnt and taught in non-English...

Ngày tải lên: 06/02/2014, 14:39

... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...

Ngày tải lên: 19/02/2014, 16:20

... (nonauto) Plastics manufacturing (auto) 26 Metal-related Metallurgical, metalworking, metal fabrication 64 75 Transportation Transportation 37 26 Cleaning/beauty care Beauty salon/hair care 25 ... large retail sector as reference (data not shown) That sector appeared to have less than average breast cancer risk (Tables 1, 3) and, as a result, all the estimates for other sectors increased considerably ... Luginaah I, Laukkanen E, Hellyer D, Reinhartz A, Watterson A, Abu-Zahra H, Maticka-Tyndale E, Schneider K, Beck M, Gilbertson M: Occupation and breast cancer: a Canadian case– control study Ann...

Ngày tải lên: 06/03/2014, 02:21

... Johanna Moore, Myroslava Dzikovska, and Elaine Farrow 2009 Using natural language processing to analyze tutorial dialogue corpora across domains and modalities In Proceedings of 14th International ... an approach for costsensitive evaluation of language interpretation within practical applications Our approach is based on the PARADISE methodology for dialogue system evaluation (Walker et al., ... 2010), Barcelona, Spain, October Myroslava O Dzikovska, Johanna D Moore, Natalie Steinhauser, Gwendolyn Campbell, Elaine Farrow, and Charles B Callaway 2010b Beetle II: a system for tutoring and...

Ngày tải lên: 08/03/2014, 21:20

Ngày tải lên: 15/03/2014, 23:20

... et al., 1999) as the final supertag This approach of voting also helps to cope with the label bias problem tag set auto auto hand hand  Table 1: Comparison with previous work Training data is ... trained with a trigram model Although supertags are able to encode long distance dependence, supertaggers trained with local information in fact not take full advantage of their strong capability ... supertag of the word, and the last is the IOB tag We first use the fast TBL (Ngai and Florian, 2001), a Transformation Based Learning algorithm, to repeat Ramshaw and Marcus’ experiment, and then apply...

Ngày tải lên: 17/03/2014, 06:20

... both as an analytical frame to design educational games and as a means to understand tool-mediated knowledge construction through game play Cultural Historical Activity Theory CHAT originated ... the learning task For example I was learning about cancer and Hiv & Aids and I like the game because it teaches about aids, cancer and malaria that those things killers and that shows us that our ... 2001) With respect to the use of games in the classroom, it was argued that games are mostly used as tutors, a learning from position rather than as tools to mediate learning, a learning with...

Ngày tải lên: 22/03/2014, 15:21

... Bolivia, Ecuador, Guatemala, Haiti, Nicaragua, Peru Bahrain, Cyprus, Iran, Jordan, Kuwait, Lebanon, Libyan Arab Jamahiriya, Oman, Qatar, Saudi Arabia, Syrian Arab Republic, Tunisia, United Arab ... Republic of Tanzania, Zambia, Zimbabwe Canada, Cuba, United States of America Antigua and Barbuda, Argentina, Bahamas, Barbados, Belize, Brazil, Chile, Colombia, Costa Rica, Dominica, Dominican Republic, ... Salvador, Grenada, Guyana, Honduras, Jamaica, Mexico, Panama, Paraguay, Saint Kitts and Nevis, Saint Lucia, Saint Vincent and the Grenadines, Suriname, Trinidad and Tobago, Uruguay, Venezuela...

Ngày tải lên: 23/03/2014, 00:20

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... report a study of the activation of various Hsp90 clients and Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a and...

Ngày tải lên: 23/03/2014, 07:20