within a few days of injury
Báo cáo khoa học: Ca2+ rise within a narrow window of concentration prevents functional injury of mitochondria exposed to hypoxia ⁄reoxygenation by increasing antioxidative defence pdf
Ngày tải lên :
30/03/2014, 11:20
... respiration at Ca2+ concentrations below and above lm (Fig 1A, upper part) Within the narrow concentration range at around lm extramitochondrial Ca2+, no effect of CSA was observed The rates of state ... (B) and the ratio of the rates of state respiration before and after the addition of NADH and cytochrome c (C) are presented The rate of state respiration of freshly isolated mitochondria was ... generated ROS, NO and permeabilization of the mitochondrial membrane are involved in mitochondrial damage Our data demonstrate that hypoxia ⁄ reoxygenation and extramitochondrial Ca2+ cause functional...
- 9
- 219
- 0
Báo cáo khoa học: "Multilingual WSD with Just a Few Lines of Code: the BabelNet API" pdf
Ngày tải lên :
07/03/2014, 18:20
... (bn:02945246n) and E TH ICAL BANKING (bn:02854884n, from Italian) An API for multilingual WSD BabelNet API BabelNet can be effectively accessed and automatically embedded within applications by means of a ... 320–330 Yashar Mehdad, Matteo Negri, and Marcello Federico 2011 Using bilingual parallel corpora for crosslingual textual entailment In Proc of ACL-11, pages 1336–1345 Rada Mihalcea, Ravi Sinha, and ... WSD approach to multilingual lexical substitution, tasks and SemEval 2010 In Proc of SemEval-2010, pages 129–133 Mitesh M Khapra, Salil Joshi, Arindam Chatterjee, and Pushpak Bhattacharyya 2011...
- 6
- 400
- 0
Báo cáo khoa học: Order within a mosaic distribution of mitochondrial c-type cytochrome biogenesis systems? pptx
Ngày tải lên :
23/03/2014, 07:20
... divergence and radiation of the six eukaryotic supergroups (Excavata, Plantae, Chromalveolata, Rhizaria, Amoebozoa and Opisthokonts)? As sophisticated bioinformatics approaches have failed to detect any ... elongation factor 1alpha Proc Natl Acad Sci USA 101, 15380– 15385 124 Andersson JO, Sarchfield SW & Roger AJ (2005) Gene transfers from Nanoarchaeota to an ancestor of diplomonads and parabasalids Mol ... falciparum (an apicomplexan) have heme lyase for maturation of mitochondrial cytochromes c [2,15,32,75–77] The mitochondrial genome sequences of various excavate, algal, plant and ciliate taxa...
- 18
- 419
- 0
báo cáo hóa học: " Simulator sickness when performing gaze shifts within a wide field of view optic flow environment: preliminary evidence for using virtual reality in vestibular rehabilitation" pptx
Ngày tải lên :
19/06/2014, 10:20
... headache, and nausea [30,31] In addition, DiZio and Lackner suggest that wearing an HMD effectively increases the mass and inertia of the head, thereby leading to a sensory rearrangement that ... There was a significant effect of visit number of the number of non-zero responses Analysis of the data revealed that subjects appeared to have greater levels of discomfort and symptoms of simulator ... both visual inputs and movements of the head and body [13] Retinal slip, i.e movement of a visual image across the retina, is a powerful signal that can induce adaptation of vestibular responses...
- 10
- 323
- 0
Báo cáo khoa học: "Temporal and spatial variation in transpiration of Norway spruce stands within a forested catchment of the Fichtelgebirge, Germany" pdf
Ngày tải lên :
09/08/2014, 04:20
... by a particular sapwood area increases A similar effect of stand age on the leaf area/sapwood area ratio of stands was reported by Albrektson [2], while Aussenac and Granier [4] showed that this ... area ratios [43] Espinosa-Bancalari et al [13] found that variations in foliage area to sapwood area ratios are strongly correlated with mean annual ring width of the sapwood, implying that growth ... curvilinearly with daily maximum D, and the maximum capacity for transpiration in all stands saturated at D values of ca max 20 hPa (figure 4) Daily maximum G t decreased strongly with increasing D max...
- 21
- 237
- 0
Báo cáo y học: " Multiple-infection and recombination in HIV-1 within a longitudinal cohort of women" potx
Ngày tải lên :
12/08/2014, 23:21
... were ED12C (AGTGCTTCCTGCTGCTCCCA) and ED31C (CCATTACACAGGCCTGTCCAAAG) and the second round primers used were DR7C (TCAACTCAACTGGTCCAAAG) and DR8C (CACTTCTCCAATTGTCCCTCA) that yield data on 694 nucleotides ... collection, maintenance and analysis of subject data, including CD4 and viral load levels and resistance patterns GWZ and QS Rousseau CM, Learn GH, Bhattacharya T, Nickle DC, Heckerman D, Chetty S, Brander ... our data using only the information gained from pol data strata and ignoring the env sequence data strata In other cases, we form a subsample at random For example, to simulate what we have found...
- 12
- 331
- 0
Báo cáo y học: "Procalcitonin kinetics within the first days of sepsis: relationship with the appropriateness of antibiotic therapy and the outcome" pptx
Ngày tải lên :
13/08/2014, 16:20
... (56.1%) Gram-negative bacteria and Gram-positive bacteria were isolated in the same proportions (48.3% and 43.9% of all isolates, respectively) Gram-negative bacteria of the enterobacteriacae family ... bacterial clearance, with or without the contribution of an appropriate antibiotic therapy The clinical relevance of such an explanation has already been demonstrated, but only at the late stage of ... first days of sepsis management Materials and methods Study population Every episode of bacteremia, community-acquired pneumonia and ventilator-associated pneumonia (VAP), as defined below, was...
- 11
- 337
- 0
báo cáo hóa học:" Isokinetic eccentric exercise can induce skeletal muscle injury within the physiologic excursion of muscle-tendon unit: a rabbit model" doc
Ngày tải lên :
20/06/2014, 00:20
... PCLAB Data Translation; Data Translation Inc., Marlboro, USA) All muscles were kept moist and at physiologic temperature (37°C) by irrigating them with warm normal saline Additional anesthesia ... subcutaneously, an incision was made from the midcalf to the plantar surface of the foot on the lateral aspect of each hind limb The Achilles tendon was isolated with special care to maintain the ... Data other than P values are the mean (standard deviation) For all groups, the stretch rate was 10 cm/min In the study group, stimulation was applied with 12 mA at a frequency of 10 Hz Page of...
- 7
- 323
- 1
Báo cáo y học: "A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention" pdf
Ngày tải lên :
13/08/2014, 14:20
... Foot All joints distal to the talocrural joint Ankle The talocalcaneal, talonavicular, talo-crural and distal tibial-fibular joints Knee The patellar-femoral articulation, tibial-femoral articulation ... professional roles associated with inter-professional acceptance and optimal standards of care [26] Methods Participation and randomization Full details of participation and randomisation have been published ... Maltby S, Hulse M, Thomas A, Hodson A, Football Association Medical Research Programme: The Football Association Medical Research Programme: an audit of injuries in professional football–analysis...
- 8
- 367
- 0
Báo cáo y học: "Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention." pot
Ngày tải lên :
13/08/2014, 15:21
... Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention Wayne Hoskins* and Henry Pollard Department of ... committee approval it has been retracted References Hoskins W, Pollard H A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury ... Chiropractic, Faculty of Science, Macquarie University, NSW 2109, Australia * Corresponding author: Wayne Hoskins waynehoskins@iinet.net.au Email: Wayne Hoskins waynehoskins@iinet.net.au Henry Pollard...
- 2
- 203
- 0
The impact of technology on team functioning within a given organization
Ngày tải lên :
21/12/2013, 00:26
... Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages -of -a- smaller-team.html [ accessed 22 May 2008 ] In addition, about administration side, team work allow manager can ... organization call virtual team 13 Veeramuthu, V ( 2008 ) Organizational behaviour – foundation of group behavior , Ha Noi : NEU A virtual team also known as a Geographically Dispersed Team (GDT) ... Instrument Basically, rely on characteristic of this approach, there is no one best way to manage and the management style appropriate both to the tasks undertaken and the nature of 12 A Overholt (March,2002)...
- 9
- 3.2K
- 2
Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt
Ngày tải lên :
19/02/2014, 07:20
... Toc75 transit peptide and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** ... *******AAA ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of ... 22 23 24 tion apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein...
- 9
- 496
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
Ngày tải lên :
20/02/2014, 02:21
... with increasing concentrations of the unlabelled fragment (lanes and 4, 10 and 100·, respectively); same fragment from which the TATATAA sequence was mutated to GATATCA (lanes and 6, 10 and 100·, ... FEBS A Parthasarthy and K P Gopinathan completely abolished when the TATATAA sequence was mutated to GATATCA (lanes 3, 4) These results were also consistent with the observation that TFIIIB alone ... from within a multigene family Gly like tRNA1 may depend on the developmental stage and the overall availability of transcription factors Gly We made a comparative analysis of two tRNA1 gene copies,...
- 15
- 484
- 0
Tài liệu The Days of Bruce Vol 1 A Story from Scottish History ppt
Ngày tải lên :
22/02/2014, 03:20
... great appearance of zeal, the guardianship of the young Earl of Fife and his sister, an office bequeathed to him under the hand and seal of the earl, his nephew The character of the Lady Isabella ... couch of disease, and rode his war-horse with all the grace and ease of former years A gallant army, under the command of Aymer de Valence, Earl of Pembroke, had already been dispatched towards ... live and die with him against all manner of men Athol, Fraser, Seaton, Douglas, Hay, gladly and willingly followed his example; and it was curious to mark the character of each man, proclaimed...
- 196
- 349
- 0
SOLVING THE PROBLEM OF CHILDHOOD OBESITY WITHIN A GENERATION potx
Ngày tải lên :
14/03/2014, 09:20
... Federal agencies and states can partner with national organizations such as the National Association of Child Care Resource and Referral Agencies (NACCRRA), the National Association for the Education ... green and orange vegetables and legumes; total grains; whole grains; milk products; meat and beans; oils; saturated fat; sodium; and calories from solid fats and added sugars USDA generally regards ... recently-enacted Patient Protection and Affordable Care Act, as amended by the Health Care and Education Affordability Reconciliation Act (collectively referred to as the “Affordable Care Act”) provides...
- 124
- 1K
- 0
Báo cáo khoa học: Differences in substrate specificities between cysteine protease CPB isoforms of Leishmania mexicana are mediated by a few amino acid changes potx
Ngày tải lên :
23/03/2014, 13:20
... pGL40: 5¢-GACGCCGGTGA AGAATCAGGGTGCGTG-3¢, OL418 to generate pGL41: 5¢-CGAACGGGCACCTGTACACGGAGGACAGC-3¢ and OL420 to generate pGL42: 5¢-GCTGCGATGACA TGAACGATGGTTGCGACGGCGGGCTGATGC-3¢ These mutant constructs ... applied to lanes 1–7 as denoted for (A) Molecular mass markers are shown in kDa The antiCPB serum recognized CPB isoenzymes that migrated as a major band with a molecular mass of 27 kDa and a ... CPB2.8 has Asn60, Asp61 and Asp64 whereas CPB3 has Asp60, Asn61 and Ser64 Interestingly, CPB18, which also has Asp60, Asn61 and Ser64 but also Tyr84 and Asn18 instead of the His84 and Asp18 in...
- 11
- 543
- 0
STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES
Ngày tải lên :
28/04/2014, 13:08
... evansi are higher than that of healthy mice * In rabbits: - Appearance time of T evansi in the blood of rabbit earliest on day and latest on day 14 after being experimentally infected Appearance ... Percentage (%) Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans ... evansi all appear clinical signs with percentage of 20 - 100 % - In trypanosome infected buffaloes there are apparently decreased amount of erythrocytes and increased amount and rates of granulocytes...
- 14
- 590
- 0
báo cáo hóa học:" Implantation of neural stem cells embedded in hyaluronic acid and collagen composite conduit promotes regeneration in a rabbit facial nerve injury model" doc
Ngày tải lên :
18/06/2014, 15:20
... dehydrated, cleared and mounted for visualization Statistics analysis Means and standard error of the mean (SEM) were calculated The one-way analysis of variance (ANOVA) was applied to analyze ... collected and analyzed data KST interpreted data and wrote the manuscript CRS, JL and HH acquired data FZC analyzed and interpret data YHA designed the study and approved the manuscript Additional material ... transection and implant of NSC and HA-collagen scaffold for 12 weeks (400× magnification) C: An array of fascicles of relatively uniform size in tissues of rabbit after facial nerve fiber transection...
- 11
- 1K
- 0