within a few days from injury
Tài liệu Adopting a Rescue Dog - The First Seven Days From Shelter to Home pdf
Ngày tải lên :
16/02/2014, 07:20
... possibly have kept him - and others with same feature - from being adopted at all What a heartbreaking thought! Believe me, it’s not that bad, and we gladly maintain his beautiful coat and our ... of adopting a dog The dogs that are in animal shelters have been examined to make sure they’re in good health before being made available for adoption The dogs are usually vaccinated, wormed and ... up from the shelter Bowls for Food and Water Metal bowls and plastic bowls are the most popular, and are very durable Ceramic bowls are available 23 24 Adopting a Rescue Dog in many designs and...
- 107
- 326
- 0
Tài liệu Báo cáo khoa học: Transcription of individual tRNA1Gly genes from within a multigene family is regulated by transcription factor TFIIIB pdf
Ngày tải lên :
20/02/2014, 02:21
... individual members from within a multigene family Gly like tRNA1 may depend on the developmental stage and the overall availability of transcription factors Gly We made a comparative analysis ... Regulation of pol III transcription A Parthasarthy and K P Gopinathan and making them unavailable for transcription The ‘TATATAA’ sequence present in the flanking regions Gly of tRNA1 -6,7 was responsible ... TATATAA sequence was mutated to GATATCA (lanes and 6, 10 and 100·, respectively) 5194 FEBS Journal 272 (2005) 5191–5205 ª 2005 FEBS A Parthasarthy and K P Gopinathan Regulation of pol III transcription...
- 15
- 484
- 0
Báo cáo khoa học: Ca2+ rise within a narrow window of concentration prevents functional injury of mitochondria exposed to hypoxia ⁄reoxygenation by increasing antioxidative defence pdf
Ngày tải lên :
30/03/2014, 11:20
... extramitochondrial Ca2+ at 30 °C Afterwards, mM glutamate, mM malate and 200 lM ADP were added to stimulate state respiration Data are presented as mean ± SEM of five preparations of mitochondria ... investigated We found that within a narrow concentration range at around lm extramitochondrial Ca2+, mitochondria were almost completely protected against decrease in active respiration and increase ... generated ROS, NO and permeabilization of the mitochondrial membrane are involved in mitochondrial damage Our data demonstrate that hypoxia ⁄ reoxygenation and extramitochondrial Ca2+ cause functional...
- 9
- 219
- 0
Báo cáo lâm nghiệp: "Plant community variability within potential natural vegetation units: a case study from the Bohemian Karst" docx
Ngày tải lên :
07/08/2014, 10:22
... Zealand Vegetation – Expanded Manual – Version Landscape Research, Manaaki Whenua: 64 Available at http://nvs.landscareresearch.co.nz Cited 20 August 2008 ISSS-ISRIC-FAO, 1998 Word reference base ... 2002 Are potential natural vegetation maps meaningful alternative to natural landscape models? Applied Vegetation Science, 5: 271–275 SCHWARZ M., 2005 Príručka prieskumu ekológie lesa Available at ... pubescenti-petraeae Folia Geobotanica and Phytotaxonomica, 32: 221–258 CHYTRÝ M., 1998 Potential replacement vegetation: an approach to vegetation mapping of cultural landscapes Applied Vegetation Science,...
- 17
- 499
- 0
Báo cáo y học: " The identification and management of ADHD offenders within the criminal justice system: a consensus statement from the UK Adult ADHD Network and criminal justice agencies" doc
Ngày tải lên :
11/08/2014, 16:23
... Foundation, Medical Research Council (MRC) and Isaac Newton Trust; and PA has received a research grant from Shire, an educational grant from JanssenCilag and grants related to ADHD from Wellcome ... treating adult ADHD [41-43], treatment with psychological therapy remains an under-researched area and a priority for future research Psychological and psychoeducational programmes are available ... Psychiatry and Landspitali University, Iceland) New Research Abstract (poster) A pilot RCT evaluation of a cognitive behavioural group treatment for adults with ADHD and antisocial behaviour” UKAAN...
- 14
- 453
- 0
Báo cáo y học: " Alveolar recruitment can be predicted from airway pressure-lung volume loops: an experimental study in a porcine acute lung injury model" ppt
Ngày tải lên :
13/08/2014, 08:21
... for analysis of PaO2, PaCO2 and pH (ABL 710; Radiometer, Copenhagen, Denmark) A central venous catheter was placed in the right internal jugular vein A bladder catheter was inserted suprapubically ... PaCO2 was – 20% These values were used Table Lung mechanics and blood gas tensions obtained at 10 cmH2O before and after LRM Parameter Before lung lavage After lung lavage After lung lavage and ... lung lavage, after lung lavage and after lung lavage and additional injurious mechanical ventilation Results are presented as medians and 25th and 75th centiles aP < 0.05, before LRM compared...
- 9
- 289
- 0
Báo cáo y học: "A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention" pdf
Ngày tải lên :
13/08/2014, 14:20
... Foot All joints distal to the talocrural joint Ankle The talocalcaneal, talonavicular, talo-crural and distal tibial-fibular joints Knee The patellar-femoral articulation, tibial-femoral articulation ... sternal-costal joint, costalchondral joints and sternal-clavicular joint Elbow The ulnar-humeral articulation and the proximal radioulnar joint Wrist The radiocarpal joint, distal radio-ulnar joint and ... Maltby S, Hulse M, Thomas A, Hodson A, Football Association Medical Research Programme: The Football Association Medical Research Programme: an audit of injuries in professional football–analysis...
- 8
- 367
- 0
Báo cáo y học: "Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention." pot
Ngày tải lên :
13/08/2014, 15:21
... Retraction: A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury prevention Wayne Hoskins* and Henry Pollard Department ... committee approval it has been retracted References Hoskins W, Pollard H A descriptive study of a manual therapy intervention within a randomised controlled trial for hamstring and lower limb injury ... Chiropractic, Faculty of Science, Macquarie University, NSW 2109, Australia * Corresponding author: Wayne Hoskins waynehoskins@iinet.net.au Email: Wayne Hoskins waynehoskins@iinet.net.au Henry Pollard...
- 2
- 203
- 0
Dragging a Movie Clip Instance within a Boundary
Ngày tải lên :
28/10/2013, 19:15
... evaluate to true because all the conditions are true—347 is greater than 60 and less than 490, and 285 is greater than 220 and less than 390 In this scenario, dragging is allowed Let's look at ... the statement) When the if statement evaluates to true, the startDrag() action is triggered and the basketball_mc instance becomes draggable The true parameter value used in this action causes ... = 490 As shown by the arrows, all coordinates are based on the distance of that side from the top and left sides of the stage TIP An easy and visual method of determining boundary coordinates...
- 7
- 221
- 0
Tài liệu Retrieving a Single Value from a Query pdf
Ngày tải lên :
14/12/2013, 18:16
... compared to retrieving a single value using an output parameter or using a DataReader, it allows a single value to be returned with the least code and may therefore improve readability and maintainability ... ExecuteScalar( ) method of the Command object returns a single value from the data source rather than a table or data stream While the ExecuteScalar( ) method does not result in a performance improvement ... therefore improve readability and maintainability If the result set returns more than one result, the first column of the first row is returned as a scalar value A null reference is returned if the...
- 2
- 312
- 0
The impact of technology on team functioning within a given organization
Ngày tải lên :
21/12/2013, 00:26
... Faster, Available from: http://www.lifehack.org/articles/lifehack/advantages-of -a- smaller-team.html [ accessed 22 May 2008 ] In addition, about administration side, team work allow manager can ... p.231) has defined team as A formal group established to achieve particular objective” 3.Now, team work is also evaluated important skill Working in a team must be practiced, as collaboration ... Instrument Basically, rely on characteristic of this approach, there is no one best way to manage and the management style appropriate both to the tasks undertaken and the nature of 12 A Overholt (March,2002)...
- 9
- 3.2K
- 2
Tài liệu Pass a Dataset Back from an XML Web Service docx
Ngày tải lên :
24/12/2013, 06:17
... columns from a data table If the goal is to include all the columns in the table and accept the Password column, then when other columns are added, you will not have to touch the code because the ... - - - ... username once again The first table from the returned dataset is assigned to the DataSource property of dgUsers Listing 13.6 frmHowTo13_4.vb: Retrieving a Dataset from a Web Service Private Sub btnLogin_Click(ByVal...
- 4
- 283
- 0
Tài liệu Getting a Sequence Value from Oracle pdf
Ngày tải lên :
21/01/2014, 11:20
... creating the sequence Oracle stores the definition of sequences for a database in a single data dictionary table in the SYSTEM table namespace As a result, all sequence definitions are always available ... CommandType.StoredProcedure; // Add the parameters and set values for them cmd.Parameters.Add(ID_PARM, OracleType.Int32).Direction = ParameterDirection.Output; cmd.Parameters.Add(FIELD1_PARM, OracleType.NVarChar, 50); ... generate a sequence of unique values for a primary key column, but is not related to the table containing the column As a result, a sequence generator can generate unique values for more than one...
- 4
- 338
- 0
Tài liệu Voices of Fear and Safety¿ Women¿s ambivalence towards breast cancer and breast health: a qualitative study from Jordan pdf
Ngày tải lên :
13/02/2014, 06:20
... “Voices of Fear and Safety” Women’s ambivalence towards breast cancer and breast health: a qualitative study from Jordan Hana Taha1,2,3* Email: hana.taha@ki.se Raeda Al-Qutob4,5 Email: raeda@johud.org.jo ... Foundation, Amman, Jordan Abstract Background Breast cancer is the leading cause of cancer mortality among Jordanian women Breast malignancies are detected at late stages as a result of deferred breast ... physicians in Crete BMC Womens Health 2008, 8:20 28 Lamyian M, Hydarnia A, Ahmadi F, Faghihzadeh S, Aguilar-Vafaie ME: Barriers to and factors facilitating breast cancer screening among Iranian...
- 19
- 513
- 0
Breaking into the Game Industry: Advice for a Successful Career from Those Who Have Done It
Ngày tải lên :
13/02/2014, 17:23
... Publisher and General Manager, Course Technology PTR: Stacy L Hiquet Associate Director of Marketing: Sarah Panella Manager of Editorial Services: Heather Talbot Marketing Manager: Jordan Castellani Acquisitions ... of my MFA work—papers, analysis, presentation—but college was an arena to develop other skills like leadership/team management and being a team player I argue that amazing games are near impossible ... games are still alive Some are still making games They have pioneered a great many genres, mastered programming algorithms and design patterns, and have learned to adapt to platform after platform...
- 304
- 1.7K
- 0
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
Ngày tải lên :
20/02/2014, 02:21
... (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate Heparin Heparin Heparin ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...
- 10
- 668
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
Ngày tải lên :
22/02/2014, 04:20
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 468/156 ... somewhat smaller on average than those in extracts from Artemia, and by way of comparison, small heat shock /a- crystallin proteins produced in transformed bacteria usually reside as oligomers similar...
- 10
- 495
- 0