with a little help from my fwends full album
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
Ngày tải lên :
20/02/2014, 02:21
... Glycosaminoglycan kass (M)1Æs)1) Antithrombin Thrombin – Heparin Heparan High affinity heparin Heparin pentasaccharide – Heparin Heparan High affinity heparin Heparin pentasaccharide – Dermatan sulfate ... Pike et al (GAGs) [3] Glycosaminoglycans such as heparin, heparan sulfate and dermatan sulfate have been found to significantly accelerate the interaction between serpins and coagulation proteases, ... Conard J, Brosstad F, Lie Larsen M, Samama M & Abildgaard U (1983) Molar antithrombin concentration in normal human plasma Haemostasis 13, 363– 368 Skinner R, Abrahams JP, Whisstock JC, Lesk AM,...
- 10
- 668
- 0
With a Little Help pptx
Ngày tải lên :
06/03/2014, 14:20
... Sussex; a pair of trousers sewn from a salvaged WWII bivouac tent; a small card advertising the availability of artisanal truffles hand-made by an autistically gifted chocolatier in Islington; a brick ... leather sofa that made amiable exhalations of good tobacco smell mixed with years of saddle soap when he settled into it Randy reached onto a tall mahogany bookcase and handed him down a first-aid kit ... louder and lean forward a little? A lot of people have that tell." "Do you work with Securitat data streams, Lawrence?" "I work with large amounts of data, including a lot of material from the...
- 282
- 494
- 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt
Ngày tải lên :
13/02/2014, 06:20
... noting, that not all patients awaiting diagnosis of possible cancer or primary treatment for Page of 11 cancer could take advantage of extra help from an NN Similar results are reported from studies, ... a healthcare professional (family or friend), hereafter labeled “closely related healthcare professionals” Trust in a closely related healthcare professional All participants had one or two among ... trust in a healthcare professional in the early part of a cancer trajectory If a participant did not have this sense of trust with regard to the physicians or did not have a helping healthcare professional...
- 11
- 695
- 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc
Ngày tải lên :
21/02/2014, 15:20
... cytochrome c oxidase from Paracoccus denitrificans Nature 376, 660–669 Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R & Yoshikawa, S (1995) ... bo3 exhibits a broad Soret peak at 425 nm and bands at 530 and 560 nm in the dark Upon irradiation with a Xe lamp (Fig 4) or with an excimer laser after 15 laser flashes at 308 nm with an intensity ... evacuated to 8–10 mbar residual pressure The sample containment, maintained at °C, was purged with dry air to minimize absorbance by water vapor A water-cooled globar was used as source of radiation,...
- 8
- 474
- 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt
Ngày tải lên :
07/03/2014, 00:20
... 203–206 Kato K, Fujiyama K, Hatanaka HS, Prijambada ID, Negoro S, Urabe I & Okada H (1991) Amino acid alterations essential for increasing the catalytic activity of the nylon-oligomer degradation ... Shibata N, Takeo M, Negoro S & Higuchi Y (2005) Crystallization and x-ray diffraction analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp KI72 Acta Crystallogr F61, 928–930 Hatanaka ... Achromobacter guttatus KI72 Eur J Biochem 80, 489–495 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masuda S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid...
- 10
- 625
- 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc
Ngày tải lên :
07/03/2014, 02:20
... CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAGGGAT TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA GCTAGGATCCCTAGCAACCACGGCAC Table Antifungal activity ... Escherichia coli and assays of recombinant WAMP 1a activity against diverse plant pathogens, such as chitin-containing and chitin-free fungi, and Grampositive and Gram-negative bacteria The amino acid ... activity of peptides was assayed against several Gram-positive and Gram-negative bacteria using radial diffusion assay Petri dishes with Luria–Bertani agar were seeded with test bacteria The peptide...
- 10
- 505
- 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx
Ngày tải lên :
07/03/2014, 15:20
... in cyanobacteria Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or low concentrations of MAAs [25] MAAs have ... acid or an amino-alcohol [11] In contrast, MAAs are UV absorbing metabolites of algae that contain an aminocyclohexenimine ring system, with UV absorption maxima between 310 and 360 nm To date, ... were harvested immediately following irradiation and analysed for pyrimidine dimer formation Non-irradiated cells and cells irradiated through a naked quartz plate served as controls As can be...
- 5
- 450
- 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
Ngày tải lên :
07/03/2014, 17:20
... 0.4 A Significant deviations for main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced ... diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector The crystals were mounted in a capillary and datasets at 295 K and were measured ... single-exponential decay in the program Origin Acknowledgements J .A. R.W and A- M.M.R are grateful to Dr N.S Pannu for help with data processing and answers to numerous questions J .A. R.W and G.W.C are grateful...
- 15
- 509
- 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx
Ngày tải lên :
23/03/2014, 12:20
... Glutamate carboxypeptidase activity in H armigera larvae Activity towards synthetic substrates for carboxypeptidase A and B (FAPP and FAAK) has previously been characterized in gut extracts from ... in the databases The two proteins migrating at 50 and 55 kDa (bands A and B; Fig 1A) were identified from their N-terminal sequences as similar to a- amylase (accession no AAA17751) from silkworm ... SDS/PAGE Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys (FAAK) and FAEE and Northern...
- 12
- 458
- 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc
Ngày tải lên :
23/03/2014, 12:20
... from rat; NaV1.7 from human; Para from fruit fly; NachB1 from squid) Conserved residues are indicated by asterisks, and conservative replacements by dots Acidic amino acids in the extracytoplasmic ... Fig Final purification and amino-acid sequence determination of Cn12 (A) A sample of fraction II-4 from a CM-cellulose ionexchange column [33] containing mg protein was applied to an analytical C18 ... it was possible to evaluate 23 JHN-Ha values from a trace of TOCSY spectra It was only possible to measure 13 additional coupling constants from TOCSY spectra as proposed by Wishart It was found...
- 13
- 434
- 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot
Ngày tải lên :
23/03/2014, 17:21
... antimicrobial peptides from South American hylids [32,34–37] and Asian, European AMWKDVLKKIGTVALHAGKAALGAVADTISQa GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa ALWKNMLKGIGKLAGQAALGAVKTLVGAE ALWKDILKNVGKAAGKAVLNTVTDMVNQa ... ACGTGCTTAGCAACGG-3¢ for caerin 1.15, and for nested PCR: 5¢-ATAACTGGAACAACGTGTGG-3¢ for caerin 1.1, 5¢-CTAAGTGCTCAGCAATGACG-3¢ for caerin 1.11, 5¢-AGCATAACTGGAACGTGGG-3¢ for caerin 1.12, 5¢-CAGCAATAAGTGGAACAACG-3¢ ... isolated India between 150 and 65 Ma and colonized the Laurasian land mass after India collided with Asia Abbreviations; AF, Africa; IND, India; AUS, Australia; SA, South America; ANT, Antartica...
- 14
- 305
- 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
Ngày tải lên :
23/03/2014, 21:20
... ultracentrifuged and the sediments and supernatants obtained were analyzed (A) lane 1, Pharmacia low molecular mass standards; lane 2, ostreolysin (noncentrifuged); lane 3, ostreolysin (supernatant); lane ... Q8WZT0) and Pseudomonas aeruginosa (TrEMBL db: Q9I710) It has been speculated that Aa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggregation ... reducing agents The samples were analyzed by SDS/PAGE using an 825% gradient polyacrylamide gel (Phast System; Pharmacia); gels were double stained, rst with Coomassie Blue and then, after destaining,...
- 12
- 492
- 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx
Ngày tải lên :
30/03/2014, 04:20
... 5¢-GTTGCCA TGGCTGTGAAATTGATGGGA-3¢ (forward), 5¢-CTCCG AGCTCTCATGGCAGTTTAAC-3¢ (reverse) and 5¢-ATA CCATGGAACAGCCAGAGTATAAAG-3¢ (forward), 5¢AGGGAGCTCTCAGAATAACTTCTCTGTA-3¢ (reverse), respectively, ... was obtained from ATTO-TEC (Siegen, Germany) All other chemicals were at least of analytical grade and were purchased from BIOMOL (Hamburg, Germany), Merck (Darmstadt, Germany), Roth (Karlsruhe, ... Assignment of subunits E and H in A- ATP synthase S Gayen et al Low-resolution structures of the enzyme show that the A1 ATPase is rather elongated, with an A3 :B3 headpiece and an elongated...
- 10
- 351
- 0
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx
Ngày tải lên :
30/03/2014, 10:20
... Tecnologica (BID 1201 ⁄ OC-AR, PICT 05–10607) ´ and Secretarı´ a de Ciencia y Tecnica de la Universidad ´ Nacional de Cordoba (SeCyT-UNC), Argentina EMG was a fellow from CONICET and GAR and CGM are ... sheets, and immunostained as previously described [16] The sucrase–isomaltase complex was identified using a mouse anti-(human sucraseisomaltase) IgG (kindly donated by Dr A Quaroni, Ithaca, NY, USA) ... have demonstrated that LT-I binding to blood group A- active glycosphingolipids from the plasma membrane of human adenocarcinoma HT29 cells elicits a signal transduction pathway, resulting in an...
- 10
- 238
- 0
images of empiricism essays on science and stances with a reply from bas van fraassen nov 2007
Ngày tải lên :
11/06/2014, 01:06
... Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Data available Typeset by Laserwords Private Limited, Chennai, India Printed in Great Britain ... isn’t as clear as van Fraassen would like to believe Chakravartty maintains that almost all inquiry is metaphysical to a degree, including van Fraassen’s stance empiricism Chakravartty also argues ... that fact Similarly, gravity waves carry the gravitational influence can only assure us that gravity waves exist if we have confidence that they are what carry gravitational influence What then about...
- 401
- 1.3K
- 0
báo cáo hóa học: " Self-efficacy instruments for patients with chronic diseases suffer from methodological limitations - a systematic review" pdf
Ngày tải lên :
18/06/2014, 19:20
... between data driven approaches (e.g use of statistical criteria using for example factor analysis), patient approach (e.g estimation of frequency or importance of the items), and an expert approach ... http://www.hqlo.com/content/7/1/86 cacy instruments for patients with the chronic diseases diabetes, COPD, asthma, arthritis, and heart failure We synthesized the data in a narrative way and used absolute numbers and proportions ... M, Havermans G: A self-efficacy scale for children and adolescents with asthma: construction and validation Journal of Asthma 1992, 29(2):99-108 Talbot F, Nouwen A, Gingras J, Gosselin M, Audet...
- 10
- 483
- 0
Báo cáo sinh học: "Functional characterization of human Cd33+ And Cd11b+ myeloid-derived suppressor cell subsets induced from peripheral blood mononuclear cells co-cultured with a diverse set of human tumor cell lines" docx
Ngày tải lên :
18/06/2014, 19:20
... on a BD FACSCalibur flow cytometer and data acquisition and analysis were performed as above Data are from three unique donors and expressed as a fraction of labeled cells within a live-cell gate ... Genetech, San Francisco, CA), anti-TNFa (Humira, Abbott, Abbott Park, IL), anti-IL-1b (clone AB-206-NA, Abcam, Cambridge, MA), anti-IL-6 (clone AB-201-NA, Abcam), anti-GM-CSF (clone BVD2), anti-TGFb ... isolated by magnetic bead separation (Miltenyi Biotec) and used for functional studies Arginase activity was measured in cell lysates using Bioassay Systems’ QuantiChrom Arginase Assay Kit (Hayward,...
- 20
- 575
- 0
báo cáo hóa học: " Too much or too little step width variability is associated with a fall history in older persons who walk at or near normal gait speed" pdf
Ngày tải lên :
19/06/2014, 10:20
... others have shown an association with similar gait characteristics[13,17] One potential explanation may be the way the gait characteristics were measured in this study Gait variability was calculated ... affect balance.)" Participants, who reported a fall, were then asked to report the number of falls in the past year Data Analysis Prior to data analyses the gait variability data were examined for ... that we examined the association of gait variability to falls over the past year where others have look at the association with future falls [2,3] In actuality, the participants' gait was measured...
- 8
- 402
- 0
báo cáo hóa học: " Serum antibodies from Parkinson''''s disease patients react with neuronal membrane proteins from a mouse " ppt
Ngày tải lên :
19/06/2014, 22:20
... PBS, washed again, and then sera was added at a 1:100 dilution in 20% normal goat serum in PBS Plates were again washed, and alkaline-phosphatase-conjugated goat anti-human IgG (H + L) (Jackson ... areas from the Western analysis (Fig 2) The r2 value was assessed by linear regression analysis (SigmaPlot 2000) and the significance (p) was calculated by Pearson correlation analysis with SigmaStat ... analysis areas from the (UPDRS – total) with Correlationthe peak of clinical scoreWestern analysis (Fig 2) Correlation analysis of clinical score (UPDRS – total) with the sum of the peak areas...
- 9
- 359
- 0
Báo cáo hóa học: " Nucleotide mismatches between the VP7 gene and the primer are associated with genotyping failure of a specific lineage from G1 rotavirus strains" potx
Ngày tải lên :
20/06/2014, 01:20
... Dutta P, Bhattacharya SK, Krishnan T, Kobayashi N, Naik TN: Genetic variability of human rotavirus strains isolated from Eastern and Northern India J Med Virol 2004, 72:156-161 Rahman M, Sultana ... site Arch Virol 1997, 142:1881-1887 Taniguchi K, Wakasugi F, Pongsuwanna Y, Urasawa T, Ukae S, Chiba S, Urasawa S: Identification of human and bovine rotavirus serotypes by polymerase chain reaction ... 2001:1747-1785 Martella V, Ciarlet M, Baselga R, Arista S, Elia G, Lorusso E, Banyai K, Terio V, Madio A, Ruggeri FM, Falcone E, Camero M, Decaro N, Buonavoglia C: Sequence analysis of the VP7 and VP4...
- 4
- 329
- 0