with a little help from my friends kinetics review

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx

Ngày tải lên : 20/02/2014, 02:21
... heparan sulfate and dermatan sulfate GAGs are physiological activa- tors of HC-II, many different polyanions, including polyphosphates, polysulfates and polycarboxylates, are able to accelerate HC-II ... Austra- lian Research Council, the National Heart Founda- tion of Australia (to RNP and AMB), Research Grants HL-06350 and HL-32656 from the National Institutes of Health (to FCC), the Institut National de ... by der- matan sulfate. Ann N Y Acad Sci 556, 116–122. 60 Maimone MM & Tollefsen DM (1990) Structure of a dermatan sulfate hexasaccharide that binds to heparin cofactor II with high affinity....
  • 10
  • 668
  • 0
With a Little Help pptx

With a Little Help pptx

Ngày tải lên : 06/03/2014, 14:20
... they take you away and then later, they always find a reason to keep you away." Lawrence's hackles were coming up. He found stuff that didn't belong in the data — he didn't arrest ... doesn't really care about space travel. It used to, or at least when I was growing up all the science fiction I read promised that space travel would someday be commonplace. That was what made it ... room lit by candles and draped with gathered curtains that turned the walls into the proscenia of a grand and ancient stage. There were four or five small tables and a long one at the back of the...
  • 282
  • 494
  • 0
How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot

How to Help With Math Homework - When the Answers Aren’t in the Book (A Guide for Students, Families, & Friends) pot

Ngày tải lên : 31/03/2014, 12:20
... go back and try that approach with the original problem. Ask if the student can make an estimate of the answer. If the answer is a number, about how big is it? Bigger or smaller than 1? ... understand the mathematical concepts Lauren Richetti, an IMP 4 student, presents a graph How to Help With Math Homework When The Answers Aren’t in the Book How to Help With Homework As you may ... Blatner Pamphlet layout and design by Jeremiah Beaudry and William Blatner Photos by William Blatner and Jackie Rigali How to Help With Math Homework When The Answers Aren’t in the Book...
  • 12
  • 480
  • 0
Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt

Tài liệu Gynecological cancer patients’ differentiated use of help from a nurse navigator: a qualitative study ppt

Ngày tải lên : 13/02/2014, 06:20
... Fremont A, Khan DC, Huang D, Knapp H, Karaman D, et al: Lay patient navigator program implementation for equal access to cancer care and clinical trials: essential steps and initial challenges. Cancer ... patients, a standard that could be met by using an NN to make need assessments, link appro- priate services to patients and make a subsequent follow-up and evaluation. Their advice was that all can- cer ... instance be done by a lay community peer, a medical assistant, a social worker or a cancer survivor with minor courses in healthcare [5,12]. It can also be done by a nurse (a Nurse Navigator...
  • 11
  • 695
  • 0
Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

Tài liệu Báo cáo Y học: Caged O2 Reaction of cytochrome bo3 oxidase with photochemically released dioxygen from a cobalt peroxo complex doc

Ngày tải lên : 21/02/2014, 15:20
... oxidase from Paracoccus denitrificans. Nature 376, 660–669. 8. Tsukihara, T., Aoyama, H., Yamashita, E., Tomizaki, T., Yamaguchi, H., Shinzawa-Itoh, K., Nakashima, R., Yaono, R. & Yoshikawa, ... sample containment, maintained at 4 °C, was purged with dry air to minimize absorbance by water vapor. A water-cooled globar was used as source of radiation, which was measured by a nitrogen-cooled ... of about 1 ms, which was evaluated without application of spectral deconvolution analysis. Using the oxygenation of myoglo- bin as a different indicator, significant flash-induced absorbance changes...
  • 8
  • 474
  • 0
Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Báo cáo khoa học: Molecular design of a nylon-6 byproduct-degrading enzyme from a carboxylesterase with a b-lactamase fold ppt

Ngày tải lên : 07/03/2014, 00:20
... 489–495. 4 Kinoshita S, Terada T, Taniguchi T, Takene Y, Masu- da S, Matsunaga N & Okada H (1981) Purification and characterization of 6-aminohexanoic acid oligomer hydrolase of Flavobacterium sp. ... S & Higuchi Y (2005) Crystallization and x-ray diffrac- tion analysis of 6-aminohexanoate-dimer hydrolase from Arthrobacter sp. KI72. Acta Crystallogr F61, 928–930. 15 Hatanaka HS, Fujiyama ... Kinoshita S, Negoro S, Muramatsu M, Bisaria VS, Sawada S & Okada H (1977) 6-Aminohexanoic acid cyclic dimer hydrolase: a new cyclic amide hydrolase produced by Achromobacter guttatus KI72....
  • 10
  • 625
  • 0
Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Báo cáo khoa học: A novel antifungal hevein-type peptide from Triticum kiharae seeds with a unique 10-cysteine motif doc

Ngày tải lên : 07/03/2014, 02:20
... CAGGCTCGTGGTGCTAAATGCCCGAACTGCCTGTGCTGTG 3f GTAAGTACGGCTTCTGCGGTTCTGGTGACGCTTACTGTGG 4f CGCTGGTTCTTGCCAGTCTCAGTGCCGTGGTTGCTAG GGAT 1r TTTAGCACCACGAGCCTGGTCACCGCAACGCTGAGC 2r CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r ... CGCAGAAGCCGTACTTACCACAGCACAGGCAGTTCG 3r GACTGGCAAGAACCAGCGCCACAGTAAGCGTCACCA Reverse GCTA GGATCCCTAGCAACCACGGCAC Table 2. Antifungal activity of WAMP- 1a. IC 50 is the concentration necessary for 50% growth inhibition. Fungi ... kiharae seeds with a unique 10-cysteine motif Tatyana I. Odintsova 1 , Alexander A. Vassilevski 2 , Anna A. Slavokhotova 1 , Alexander K. Musolyamov 2 , Ekaterina I. Finkina 2 , Natalia V. Khadeeva 1 ,...
  • 10
  • 505
  • 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Ngày tải lên : 07/03/2014, 15:20
... M. & Dembitsky, V.M. (2003) Characterization of surface n-alkanes and fatty acids of the epiphytic lichen Xanthoria parietina, its photobiont a green alga Trebuxia sp. and its mycobiont, from ... which possess a common cyclohexenone ring system linked by an aminoacidoranamino-alcohol[11].Incontrast,MAAsare UV absorbing metabolites of algae that contain an amino- cyclohexenimine ring system, with ... ten photons from hitting cytoplasmic targets in cyanobacteria. Cells with high concentrations of MAAs are approximately 25% more resistant to UV radiation centered at 320 nm than those with no or...
  • 5
  • 450
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Ngày tải lên : 07/03/2014, 17:20
... diffraction data of the wt and M100K crystals were collected on an in-house beam using a MAR345 Image Plate detector. The crystals were mounted in a capil- lary and datasets at 295 K and were measured ... single-exponential decay in the program Origin. Acknowledgements J .A. R.W. and A- M.M.R. are grateful to Dr N.S. Pan- nu for help with data processing and answers to numerous questions. J .A. R.W. and G.W.C. are ... Katayama Y, Hiraishi A & Kuraishi H (1995) Para- coccus thiocyanatus a new species of thiocyanate utiliz- ing facultative chemolithotroph, and transfer of Thiobacillus versutus to the genus Paracoccus...
  • 15
  • 509
  • 0
Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Báo cáo khoa học: Characterization of a digestive carboxypeptidase from the insect pest corn earworm (Helicoverpa armigera) with novel specificity towards C-terminal glutamate residues pptx

Ngày tải lên : 23/03/2014, 12:20
... which had extra bases added to include PstI(N-terminal)andSalI (C-terminal) restriction sites: Forward, 5Â-CGCGCTGCA GGTCATGAGAAATATGAAGGA-3Â;Reverse,5Â-GC GCGTCGACTGAATAGTTTTGCAAGACGTACTG-3Â. They ... and analysed by SDS/PAGE. Carboxypeptidase assays and expression of HaCA42 mRNA Carboxypeptidase assays using the synthetic substrates furylacryloyl-Phe-Phe (FAPP), furylacryloyl-Ala-Lys (FAAK) ... serine protease (Y12274) B (50) YKNPYYAPGR(S)VNVN Bombyx mori ALAY KNPHYAS GR T TMVHLFE a- amylase (AAA17751) A (55) YLNPXY Bombyx mori ALAYKNPHYASGRTTMVHLFE a- amylase (AAA17751) 6 M guanidine hydrochloride E...
  • 12
  • 458
  • 0
Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Báo cáo khoa học: NMR solution structure of Cn12, a novel peptide from the Mexican scorpion Centruroides noxius with a typical b-toxin sequence but with a-like physiological activity doc

Ngày tải lên : 23/03/2014, 12:20
... 3 of Na + channels. A total of 50 nonredundant sequences of Na + channels available in databases were aligned with CLUSTAL X [45]. The segments S5–S6 of domain I and S3–S4 of domain IV from selected sequences ... are shown (Na V 1.1, 1.4 and 1.5 from rat; Na V 1.7 from human; Para from fruit fly; NachB1 from squid). Conserved residues are indicated by asterisks, and conservative replacements by dots. Acidic ... binds to neuronal preparations from cockroach with a 10 000- fold higher affinity than to rat brain synaptosomes [51]). In addition, some toxins are capable of discriminating between Na + -channel isoforms...
  • 13
  • 434
  • 0
Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

Báo cáo khoa học: Antimicrobial peptides from hylid and ranin frogs originated from a 150-million-year-old ancestral precursor with a conserved signal peptide but a hypermutable antimicrobial domain pot

Ngày tải lên : 23/03/2014, 17:21
... GWMSKIASGIGTFLSGMQQa DRS B1 AMWKDVLKKIGTVALHAGKAALGAVADTISQa DRS B2 GLWSKIKEVGKEAAKAAAKAAGKAALGAVSEAVa DRS B3 ALWKNMLKGIGKLAGQAALGAVKTLVGAE DRS B4 ALWKDILKNVGKAAGKAVLNTVTDMVNQa DRS B6 ALWKDILKNAGKAALNEINQLVNQa PBN2 ... 5Â-GAAGT ACGTGCTTAGCAACGG-3Â for caerin 1.15, and for nested PCR: 5Â-ATAACTGGAACAACGTGTGG-3Â for caerin 1.1, 5Â-CTAAGTGCTCAGCAATGACG-3Â for caerin 1.11, 5Â-AGCATAACTGGAACGTGGG-3Â for caerin 1.12, 5Â-CAGCAATAAGTGGAACAACG-3Â ... South America and probably reached Australia via the connection with Antartica and South America [66]. Evidence for the dispersal of land vertebrates from South America to Australia via Antartica also...
  • 14
  • 305
  • 0
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx

Ngày tải lên : 23/03/2014, 21:20
... breast adenocarci- noma, were obtained from the Istituto Zooprofilattico Sperimentale della Lombardia e dell’Emilia, Brescia, Italy. Lipids. A series of natural and synthetic lipids and derivatives ... aerugi- nosa (TrEMBL db: Q9I710). It has been speculated that Aa-Pri1, and similar proteins, may have important roles in the initial phase of fungal fruiting, such as hyphae aggre- gation [4], or in apoptosis ... the secondary structure of ostreolysin with and without lipids. Values are mean ± SD. b 1 , Anti- parallel b-sheet; b 2 , parallel and antiparallel b-sheet; t, b-turn; a, a- helix; r, random coil;...
  • 12
  • 492
  • 0
Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

Báo cáo khoa học: Identification of critical residues of subunit H in its interaction with subunit E of the A-ATP synthase from Methanocaldococcus jannaschii potx

Ngày tải lên : 30/03/2014, 04:20
... 5Â-GTTG CCA TGGCTGTGAAATTGATGGGA-3Â (forward), 5Â-CTCCG AGCTCTCATGGCAGTTTAAC-3Â (reverse) and 5Â-ATA CCATGGAACAGCCAGAGTATAAAG-3Â (forward), 5 Â- AGG GAGCTCTCAGAATAACTTCTCTGTA-3Â (reverse), respectively, ... the A- ATP synthase from Methanocaldococcus jannaschii Shovanlal Gayen, Asha M. Balakrishna, Goran Biukovic , Wu Yulei, Cornelia Hunke and Gerhard Gru ă ber School of Biological Sciences, Nanyang ... Ger- many). Atto488–maleimide was obtained from ATTO-TEC (Siegen, Germany). All other chemicals were at least of analytical grade and were purchased from BIOMOL (Ham- burg, Germany), Merck (Darmstadt,...
  • 10
  • 351
  • 0
Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx

Báo cáo khoa học: Functional interaction of Escherichia coli heat-labile enterotoxin with blood group A-active glycoconjugates from differentiated HT29 cells docx

Ngày tải lên : 30/03/2014, 10:20
... Func- tionally, differentiation was accompanied by the expression of aminopeptidase N, lactase, maltase and sucrase activities. Sucrase-isomaltase is localized at the apical brush border membranes of HT29 ... A. Roth and Clara G. Monferran Departamento de Quı ´ mica Biolo ´ gica – CIQUIBIC (CONICET), Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Argentina The type I heat-labile ... receptors Correspondence C. G. Monferran, Departamento de Quı ´ mica Biolo ´ gica, Facultad de Ciencias Quı ´ micas, Universidad Nacional de Co ´ rdoba, Ciudad Universitaria, Co ´ rdoba X5000HUA, Argentina Fax: +54 351...
  • 10
  • 238
  • 0

Xem thêm