will to learn and the assemblage of a learning apparatus

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt

... years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical ... interviewers and translators stayed in the orphanage and shared the meals with the children and played with them in their free time Analyses All variables except one met the preconditions for the analyses ... developmental stages, attachment, and bonding was given to the caretakers to foster their understanding and empathy towards the children Grief: As many of the children have lost their parents also some...

Ngày tải lên: 13/08/2014, 18:22

9 405 0
DSpace at VNU: Holding the line: family responses to pregnancy and the desire for a child in the context of HIV in Vietnam

DSpace at VNU: Holding the line: family responses to pregnancy and the desire for a child in the context of HIV in Vietnam

... took another woman home and told me that he would marry her instead My parents and grand parents-in-law seemed happy to have a new daughter-in-law That woman even came to my room and said that ... that has influenced Vietnamese culture, sons make the ancestral sacrifices, pray to the ancestors and carry on the family line; failure to have children, especially a son, is a disgrace to the ... under the influence of ancestors and the weight given to them within the culture Key in this regard is the need for parents and grandparents to have male offspring Health workers share these ideas...

Ngày tải lên: 16/12/2017, 17:16

16 191 0
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an...

Ngày tải lên: 03/01/2014, 19:44

8 518 1
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf

... structure of the protein Figure shows the fluorescence spectra of wild-type SNase and the four mutants E142O, K13 3A, W14 0A and W140O The fluorescence spectra of E142O and K13 3A are similar to that of the ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgỈmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 ... Experimental procedures Materials B Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA,...

Ngày tải lên: 20/02/2014, 01:20

7 552 0
MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx

... serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and not an actual one, cannot serve as a standard of value, but is referred, on the contrary, to silver and ... in a twofold way, and has therefore a twofold value and a twofold price,—one value as an article that can be exchanged for other commodities, and another value as an article that can be loaned ... a fair day's wages, and that one man by a certain process can produce an article valued in the market at one dollar in half a day's labor, other men will take advantage of the same process, and...

Ngày tải lên: 29/03/2014, 08:20

46 327 0
Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot

Báo cáo khoa học: "From RAGS to RICHES: exploiting the potential of a flexible generation architecture" pot

... representation language An O /A database consists of a collection of objects, each of which has a unique identifier and a type, and arrows, each of which has a unique identifier, a type, and source and ... DocLeafs) and DocLeafs The active database server supports multiple independent O /A databases Individual modules of an application publish and retrieve objects and arrows on databases, incrementally ... Referring Expression Generation, commonly viewed as a single task, needs to have access to at least rhetorical and an implementation of the RAGS Object and Arrows (O /A) data representation,   support...

Ngày tải lên: 31/03/2014, 04:20

8 368 0
introduction to languages and the theory of computation

introduction to languages and the theory of computation

... be to rely on the clarity and efficiency of appropriate mathematical language and to add informal explanations to ease the way, not to substitute for the mathematical language but to familiarize ... obvious what the function r is, you can see after using the definition to compute r(aaba), for example, r(aaba) = ar(aab) = abr(aa) = abar (a) = abar( a) = abaar( ) = abaa = abaa that it is the function ... elements of F , in addition to the four from statement 1, are {a, b}, {ab}, {a, b, ab}, {aba, abb, abab}, and {aa, ab, aab, ba, bb, bab} The first of these is the union of {a} and {b}, the second is the...

Ngày tải lên: 31/05/2014, 00:58

449 582 0
peer-to-peer harnessing the benefits of a disruptive technology

peer-to-peer harnessing the benefits of a disruptive technology

... shared database: organized manual, organized mechanical, and volunteer manual The classic case of an organized manual database is the original Yahoo! directory This database was filled by organizing ... mainland is too slow Instead, we record the data on digital tapes and mail them to Berkeley The largest-capacity digital tape available in 1998 was the 35-GB digital linear tape (DLT) We had to ... to another - the MP3 files not have to travel through any central Napster server Instead of trying to store these files in a central database, Napster took advantage of the largest pool of latent...

Ngày tải lên: 01/06/2014, 10:58

265 535 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot

... Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the...

Ngày tải lên: 18/06/2014, 22:20

5 483 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt

... Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and ... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the...

Ngày tải lên: 20/06/2014, 04:20

5 430 0
Exposure to Traffic and the Onset of Myocardial Infarction potx

Exposure to Traffic and the Onset of Myocardial Infarction potx

... registry.13 Cases are identified daily at the Central Hospital and once a week at six hospitals in the city of Augsburg and the two adjacent rural districts and at four hospitals near the study area The ... individuals at any stage of training The editorial fellow will work on Journal projects and will participate in the day -to- day editorial activities of the Journal but is expected in addition to have ... 1999, and afterward the diary was revised to improve its clarity, minimize redundancy, and facilitate the statistical analysis Adherence to standardized procedures for the interview and coding was...

Ngày tải lên: 27/06/2014, 00:20

11 372 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc

... experiments, analyzed the data, and wrote the manuscript AC, LS, ATw, and LM carried out the experimental work All authors read and approved the final manuscript 14 15 16 Additional data files The following ... mutation events and thus can only be considered an approximation, but they are comparable to a similar mutation rate reported in the malaria parasite Plasmodium falciparum of 0.00016 mutants/allele ... salivary glands (transmission index), and in their ability to resist killing by a number of trypanocidal drugs used in the treatment of human African trypanosomiasis [18] The availability of a...

Ngày tải lên: 14/08/2014, 20:22

12 281 0
lepler - the many panics of 1837; people, politics, and the creation of a transatlantic financial crisis (2013)

lepler - the many panics of 1837; people, politics, and the creation of a transatlantic financial crisis (2013)

... work to the Organization of American Historians, the American Historical Association, the American Studies Association, the Society for Historians of the Early American Republic, the History of Acknowledgments ... Pennsylvania, the American Antiquarian Society, the Baker Library of the Harvard Business School, the Boston Public Library, the Massachusetts Historical Society, and the Boston Athenaeum Some of the ... owe a heartfelt thanks to the staff at the Rothschild Archive, the Bank of England Archive, the Baring Archive, the British Library Newspaper Reading Room, the National Archives at Kew, the Manuscript...

Ngày tải lên: 01/11/2014, 12:16

358 324 0
mallaby - more money than god; hedge funds and the making of a new elite (2010)

mallaby - more money than god; hedge funds and the making of a new elite (2010)

... Money T han God ALSO BY SEBASTIAN MALLABY The World’s Banker: A Story of Failed States, Financial Crises, and the Wealth and Poverty of Nations After Apartheid: The Future of South Africa MORE ... inherited the wanderlust of his father, he signed on as a purser on a tramp steamer and spent a year touring the world He took a job as an export buyer and another as a statistician for an investment ... by taxpayers and into ones that stand on their own feet They need to shrink institutions that are too big to fail and favor ones that are small enough to go under The story of A W Jones and his...

Ngày tải lên: 01/11/2014, 21:26

497 380 0
Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation

Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation

... rest of the regional grouping need to be taken into account It may be the case that eradicating the piracy from the Strait of Malacca forces pirates to operate in other areas of Southeast Asia, effectively ... like Vietnam and China appear to take over the ASEAN Summit agenda This seemed to have been the case at the 24th ASEAN Summit in Nay Pyi Taw, Myanmar Such disputes are divisive to the ASEAN community, ... deal with the threat to international shipping posed by piracy and armed robbery against ships In the Malacca Straits The issue of maritime piracy in the Strait of Malacca seems to have resurfaced...

Ngày tải lên: 30/09/2015, 10:12

129 531 0
The use of credit scoring models and the importance of a credit culture

The use of credit scoring models and the importance of a credit culture

... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... n .a AAA BBBABBB AA AAA AAA BB+ Dec 02 BB AA+ B+ AAA CCC+ AA A BBB B- S&P Rating Dec 02 BBB+ BBB+ BBBBBB CCC BBBABBB+ B+ AAAmerica Movil BBB+ Cemex Kimberly-Clark de Mexico Telefonos de Mexico Apasco ... Total Assets Total Assets Total Assets BV of Liability Z''-Score Safe zone 8.15 7.60 7.30 7.00 6.85 6.65 6.40 6.25 5.85 > 8.15 8.15 7.60 7.30 7.00 6.85 6.65 6.40 6.25 Rating AAA AA+ AA AAA+ A...

Ngày tải lên: 04/10/2015, 10:26

90 920 0
Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

Basic understanding about cancer and the importance of a national surveillance and research program in Vietnam

... in the growth, spread and death avoiding machinery of cancer (12) The main advantage of targeted therapy is that they focus to the specific cellular and molecular changes of cancer cells; therefore, ... Carcinoma of the urinary system Cancer can occur anywhere along the urothelium, an epithelial layer lining the urinary tract Cancer of the urothelium is referred to as urothelial carcinoma (Adapted ... Malignant cancer cells invade nearby tissue and metastasize to distant organ sites (1-5) There are five main therapies for cancer treatment: chemotherapy, radiotherapy, surgery, and targeted therapy...

Ngày tải lên: 20/06/2016, 23:20

7 462 0
w