why is it a major problem for users

... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' T7 5'-TAATACGACTCACTATAG-3'...

Ngày tải lên: 09/08/2014, 10:23

... Trust Managing Director of provider company; General Manager of Health Board Senior Management Clinical Lead for Hospital Trust Clinical Lead for Hospital Trust IT Manager Health Board; Clinical ... a decreasing pool of referrals C and B became a central part of this hospital’s business plan to maintain inward referrals and hence overall financial viability: ‘So I wanted to make it so easy ... Doctors, radiologists, radiography administrative staff Community nurses district nurses in an urban area in Scotland The CNIS consisted of hand-held wireless enabled Personal Digital Assistant devices...

Ngày tải lên: 10/08/2014, 10:23

... A major obstacle of utilizing NSCs in clinical applications is the need for fetal brain tissue There is limited availability of fetal tissue and it raises multiple moral and ethical complications ... therefore appears to induce stem cell transmigration across an endothelial barrier [53] In addition, HMGB1 acts as a pro-inflammatory factor, and is released by damaged cells as a chemoattractant ... HMGB1 was observed to play a role in inflammation, cell migration and metastasis Palumbo et al reported that HMGB1 attract mesoangioblast to migrate across an endothelial monolayer and reach damaged...

Ngày tải lên: 09/09/2015, 08:17

... obviously a simplified description that abstracts from many important practical details For instance, it is clear that capital gains may be taxed at a rate different from labor income; in reality, ... stNIPA +1 which may be sometimes substantial and—even when ρt+1 = rt+1, that is, all capital gains are realized—never disappears as long as rt+1 ≠ Formally, this means that while the NIPA personal ... credit markets with modest transaction costs—capital gains not need to have been realized to cause an increase in personal outlays: Unrealized capital gains may be used as collateral to support additional...

Ngày tải lên: 16/02/2014, 11:20

... All information contained in this document was correct at the time of going to print, and is available in alternative formats on request For further information please visit our website at:- ... consider before committing yourself to applying for a patent, a summary of the patenting process in the UK and abroad Patents: Basic Facts This guide is all about how to apply for a UK patent Before ... 250 Fax: 01633 817777 This leaflet provides basic information on some areas of trade marks It is not a reference book and has no legal authority www.ipo.gov.uk For copies in alternative formats...

Ngày tải lên: 29/03/2014, 18:20

... the past decade, Tunisia and Morocco have attracted larger FDI inflows, 29 Italy USA Spain Portugal Kuwait France SaudiArabia France Spain Sweden Portugal Italy Germany SaudiArabia Netherlands ... Maghreb countries’ revealed comparative advantage and export specialization also reveals that Tunisia’s exports of beverages have a strong comparative advantage in the Maghreb market whereas Algeria ... intraregional trade remains limited and compares unfavorably with other regional blocs Merchandise trade within the Maghreb (as a share of total merchandise trade) is the lowest among comparator...

Ngày tải lên: 22/05/2014, 12:51

... us, wishing to participate in this weaver ant training in order to establish a weaver ant farm To assist with this endangered animal conservation program, we strongly supported their idea and accepted ... Thai and his assistant for this weaver ant technology training Organization of Farmer Field School This activity is for the first year TOT graduates to conduct FFS in their local region A total ... plot, and the small black ant, Tapinoma melanocephalum that was abundant on the remaining trees of the plot The Crematogaster ants were nesting on cashew tree branches and the small black ant were...

Ngày tải lên: 21/06/2014, 05:20

... South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced February 2006 ... black ant, Tapinoma melanocephalum, that was abundant on the remaining trees of the plot Baiting of competitive ant species Ant baits (Amdro and Campaign ant bait) brought from Australia were tried ... Position: Organisation Charles Darwin University Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative contact Jenny Carter Name: Research Manager...

Ngày tải lên: 21/06/2014, 06:20

... Vietnam, there are at least 10 major insect pests and three diseases as well as many important species of natural enemies such as parasitoids and beneficial fungi in cashew orchards These data clearly ... these data, extensive and intensive training about the biology of the ant is crucial for this project All the data obtained in this survey will be used for a comparison between ‘before’ and ‘after’ ... Mulching and irrigation were generally not practiced Pesticide spray has already caused health problems in farmers and their animals, and problems with the environment This project will focus on this...

Ngày tải lên: 21/06/2014, 06:20

... Institution Institute of Agricultural Science of South Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian ... Team Leader Keith Christian Name: Professor Position: Organisation Charles Darwin University Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative ... (2) to make them aware of the existence and the role of natural enemies (especially weaver ants) on cashew trees, and (3) to provide them with information about the advantages and disadvantages...

Ngày tải lên: 21/06/2014, 06:20

... Abamectine and water, respectively Data analysis For field experimental data analyses, on each monitoring occasion, two plots (farmer and IPM) were ranked, based on mean percentage damage by each major ... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... tree had weaver ants Apart from weaver ants, we also found ghost ants (Tapinoma melanocephalum), small sized crematogaster ants (Crematogaster sp) and an unidentified black ant in this orchard,...

Ngày tải lên: 21/06/2014, 06:20

... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... University Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative contact Jenny Carter Name: Research Manager Position: Organisation Charles Darwin ... date (original) January 2009 Completion date (revised) Reporting period July 2008 Contact Officer(s) In Australia: Team Leader Keith Christian Name: Professor Position: Organisation Charles Darwin...

Ngày tải lên: 21/06/2014, 06:20

... Vietnam Vietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Date commenced February 2006 ... Australia: Team Leader Keith Christian Name: Position: Professor Organisation Charles Darwin University Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative ... “Integrated cashew improvement program using weaver ants as a major component - Manual for ICI program trainers and extension officers in Vietnam” Charles Darwin University, Australia and Institute...

Ngày tải lên: 21/06/2014, 06:20

... Position: Organisation Charles Darwin University Telephone: Fax: Email: 61 89466706 61 89466847 keith.christian@cdu.edu.au In Australia: Administrative contact Jenny Carter Name: Research Manager ... South Vietnam Vietnamese Project Team Leader Professor Dr Pham Van Bien Australian Organisation Charles Darwin University Australian Personnel Dr Keith Christian and Dr Renkang Peng Date commenced ... Trees with abundant crematogaster ants were much less damaged by these two pests than trees with a few crametogaster ants or without ants or with black ants (Table 4) This is a new finding of this...

Ngày tải lên: 21/06/2014, 06:20

... elastodynamics and general relativity,” Archive for Rational Mechanics and Analysis, vol 63, no 3, pp 273–294, 1977 S Yakubov and Y Yakubov, Differential-Operator Equations Ordinary and Partial ... Y Yakubov, “Hyperbolic differential-operator equations on a whole axis,” Abstract and Applied Analysis, no 2, pp 99–113, 2004 P Lancaster, A Shkalikov, and Q Ye, “Strongly definitizable linear ... Differential Equations, vol 103 of Chapman & Hall/CRC Monographs and Surveys in Pure and Applied Mathematics, Chapman & Hall/CRC, Boca Raton, Fla, USA, 2000 S Q Krein, Linear Differential Equation in Banach...

Ngày tải lên: 21/06/2014, 11:20

... development as a national priority The area growing cashew is about 430000 located in Central Highlands, South Central Coast and South East region Cashew is planted mainly in inverse soils that are low ... program using weaver ants as a major component Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information about cashew botany, breeding, ... program using weaver ants as a major component – ICI Photo Book for cashew growers in Vietnam” Charles Darwin University, Australia and Institute of Agricultural Science for South Vietnam, Vietnam...

Ngày tải lên: 22/06/2014, 12:20

... equilibria for a beam with a nonlinear elastic foundation, Portugaliae Mathematica 51 (1994), no 3, 375–393 [4] B V Kapitonov and G Perla Menzala, Energy decay and a transmission problem in electromagneto-elasticity, ... beams, Adn vances in Mathematical Sciences and Applications 12 (2002), no 1, 1–20 [15] S Nicaise, Boundary exact controllability of interface problems with singularities II Addition of internal controls, ... SIAM Journal on Control and Optimization 35 (1997), no 2, 585–603 [16] A F Pazoto and G Perla Menzala, Uniform stabilization of a nonlinear beam model with thermal effects and nonlinear boundary...

Ngày tải lên: 22/06/2014, 22:20

... equilateral triangle TA ⊂ T is called a special triangle corresponding to vertex A if TA is a smaller homothetic copy of T having A as a common vertex, e.g., ∆AU V in Fig 1 (a) Special triangles TB and TC ... (a) and (b): Extend/shrink operations on T A = ∆AA1 A2 and a negative triangle T = ∆M N P (phase 2, case 2c) Note that any of the original triangles Ti in the covering set may participate in at ... triangles For instance, in phase for vertex A, the two triangles ∆M N P and ∆AU V covering A are replaced by the special triangle ∆ARS For vertex B, the triangle ∆GEF which contains B is replaced...

Ngày tải lên: 07/08/2014, 15:23

... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Osaka city, Osaka 540-0006 Japan Department of Radiation Oncology, Osaka University Graduate School of Medicine, Yamadaoka 2-2, Suita, 565-0871 Osaka, Japan 4Department of Maxillo-Facial Radiology, ... (ulceration lasting months or more) and/or bone (bone exposure and necrosis) reactions occurred Statistical Analysis For a statistical analysis, a Student’s t-test for normally distributed data and...

Ngày tải lên: 09/08/2014, 09:20

... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across at least three reactions in which approximately equal amounts of sample ... numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount...

Ngày tải lên: 11/08/2014, 08:20