when the federal government implements a large pay increase for its employees why do rents for apartments located near washington metro stations go up relative to rents for apartments located far away from metro stations

Tài liệu CUSTOMER SATISFACTION MEASUREMENT ISSUES IN THE FEDERAL GOVERNMENT doc

Ngày tải lên : 11/12/2013, 23:15

... through taxes, may be paying for an agency's products and services An example of a passive customer would be someone who listens to the radio to hear information from the National Weather Service The ... philosophical answer would be that as a Governmental agency, it is our duty to consider them to be customers After all, someone (the taxpayer) is paying the agency to provide these products and services ... Index" was used to assess the amount of bureaucratic red tape which was necessary to obtain each category of products or services There are many factors that determine whether an evaluative survey...

6
578
0

"ACCOUNTING FOR LIABILITIES OF THE FEDERAL GOVERNMENT" docx

Ngày tải lên : 23/03/2014, 03:20

... Obligations," as revised from time to time by the Actuarial Standards Board.[FN 41: The Actuarial Standards Board is a board within the American Academy of Actuaries that sets professional standards ... existing law and policy made it probable that the federal government would pay for the damages and to the extent that the amount of the payment could be estimated reliably [FN 21: The vast majority ... cleanup from federal operations resulting in hazardous waste that the federal government is required by statutes and/or regulations, that are in effect as of the Balance Sheet date, to clean up...

97
435
0

Báo cáo y học: " Draft genome sequence of the Daphnia pathogen Octosporea bayeri: insights into the gene content of a large microsporidian genome and a model for host-parasite interactions" pps

Ngày tải lên : 09/08/2014, 20:20

... Nosema ceranae 100 Nosema ceranae 100 Encephalitozoon cuniculi Antonospora locustae 99 100 97 100 Paranosema grylli ATP transporters Clade I Antonospora locustae Antonospora locustae Ancestral ATP ... uncultivatable organisms from which only a handful of contaminant-free DNA can be extracted Finally, an important goal of the present study was to gather a large amount of genome sequence information ... another, as are Antonospora and Brachiola The remaining species all branch more deeply, and O bayeri is in this tree basal to all other microsporidian species from which large genome sequence data are...

12
400
0

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Ngày tải lên : 13/08/2014, 09:20

... dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed to identify differentially expressed ... (5' to 3'): β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... LOX1(forward): ACTGTGAAGGACCAGCCTGATG, LOX1(reverse): CCTAGAGTCGCAGCAGCCAG, CD88(forward): TCAAGGTGGTGGTGGCAGTG, CD88(reverse): GTGACGATGGCTCCAGGAAGG, P21(forward): AGCAGCGGAACAAGGAGTCAG, P21(reverse):...

16
178
0

2010 identifying the missing tags in a large RFID system

Ngày tải lên : 03/11/2015, 21:21

... that a reader array is installed to extend the coverage When there are multiple synchronized readers, we logically treat them as one We assume that the RFID reader has access to a database that ... each tag transmits its ID for 2.72 times on average, which is the theoretically optimal value After a tag transmits its ID, it must wait for the acknowledgement from the reader Because the acknowledgement ... out of a warehouse — remove some tags from the system and the tag IDs in the database are not timely updated, a false alarm will be triggered To alleviate such confusion to the warehouse management,...

10
591
0

Báo cáo khoa học: "Building a Large Knowledge Base for a Natural Language System" doc

Ngày tải lên : 17/03/2014, 19:21

... us to encode the facts that all of these are aspects of a disease "laboratory animals", "laboratory spores", "laboratory contamination", "laboratory nwthods" "a study by a research laboratory", ... "disease transmission" Initial attempts to axiomatize them in4icated the need for axioms, in the "naive topology" domain, about m(unbranes and the penetration of membranes allowing substances to ... topolog'y The domain of time is seen as a particular kind of scale defined by change of state, and the axiomatization builds toward such predicates as "regular" and "persist" The domain of belief has...

4
364
0

HMDB: A Large Video Database for Human Motion Recognition pdf

Ngày tải lên : 23/03/2014, 12:20

... scale and viewpoint of the actors, as well as cluttered background The UCF50 dataset extends the 11 action categories from the UCF YouTube dataset for a total of 50 action categories with real-life ... Center for Computation and Visualization, and the Robert J and Nancy D Carney Fund for Scientiﬁc Innovation, by DARPA (DARPA-BAA-09-31), and ONR (ONR-BAA11-001) H.K was supported by a grant from the ... to- date the largest and perhaps most realistic available dataset Each clip was validated by at least two human observers to ensure consistency Additional meta information allows for a precise selection...

8
469
0

Báo cáo hóa học: " Research Article The Personal Hearing System—A Software Hearing Aid for a Personal Communication System" ppt

Ngày tải lên : 21/06/2014, 19:20

... devices, for example, the iPhone [8] or the GooglePhone [9] These devices can act as a central processor for hearing aids with access to binaural audio information and the advantage of increased ... conventional hearing aids Another factor that inﬂuences and might facilitate the further development of hearing support systems is the availability of standard hardware and open software for mobile ... framework for hearing aid algorithms Another hardware-related factor is the development of Wireless Body Area Networks (WBANs) that can be seen as an enabling technology for mobile health care...

9
405
0

Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx

Ngày tải lên : 10/08/2014, 10:20

... disease: Doppler echocardiography is the clinician's Rosetta stone JAAC 1997, 30:8-18 Yamamoto K, Masuyama T, Tanouchi J, Doi Y, Kondo H, Hori M, Kitabatake A, Kamada T.: Effects of heart rate on ... mortality and cardiovascular event risk [81,82] Age Aging is correlated to DD through an increase upon wall thickness (secondary to enlargement of cardiac myocytes), and changes in the vasculature, the ... dysfunction and diastolic heart failure: Part II: Causal mechanisms and treatment Circulation 2002, 105:1503-8 Angeja B, Grossman W: Evaluation and management of diastolic heart failure Circulation 2003,...

10
490
0

Báo cáo y học: "Carpal tunnel syndrome and the "double crush" hypothesis: a review and implications for chiropractic" pps

Ngày tải lên : 13/08/2014, 14:20

... chiropractic care of CTS (Table 1), and only Mariano et al [38] claimed a patient to have had a case of DCS Diagnosis of cervical radiculopathy was based on pain in the neck and upper back, pain radiating ... motor fibers (as manifested by abductor pollicus weakness and EMG findings) Another possibility is that the Mariano case actually was cervical radiculopathy, alone Alternatives to the Upton and ... 10:365-369 Baba H, Maezawa Y, Uchida K, Furusawa N, Wada M, Imura S, Kawahara N, Tomita K: Cervical myeloradiculopathy with entrapment neuropathy: a study based on the double-crush concept Spinal Cord...

9
347
0

1593272944 {8C789BFD} the book of ruby a hands on guide for the adventurous collingbourne 2011 07 16

Ngày tải lên : 07/01/2017, 20:50

... need to multiply the subtotal by the applicable tax rate and add the result to the value of the subtotal Assuming the subtotal to be $100 and the tax rate to be 17.5 percent, this Ruby program does ... In the previous example, I assigned values to variables such as subtotal, tax, and taxrate Variables such as these that begin with a lowercase character are called local variables This means they ... Classes, and Obj ect s On the other hand, a global variable—one that begins with the dollar sign character ($)—has global scope When an assignment is made to a global variable inside a method, that affects...

402
864
0

báo cáo hóa học:" The results of arthroscopic versus mini-open repair for rotator cuff tears at mid-term follow-up" pot

Ngày tải lên : 20/06/2014, 01:20

... regimen for the arthroscopic repair was identical to that for the mini-open repair Analysis of the Data and Statistics Descriptive analysis was performed for patient demographics and for all variables ... manuscript/data analysis 21 KAI – Collected data/data analysis 22 23 SGM – Data analysis/assisted with manuscript 24 All authors read and approved the final manuscript 25 Acknowledgements The authors ... had acromioclavicular joint pain These examination included palpation of the AC joint, the "cross-arm test" and the O'Brien test If the patient had pain localized to the AC joint and had at least...

8
467
0

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Ngày tải lên : 24/12/2013, 01:17

... property of the DataColumn SetNull Indicates that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn ... push the deletes to the parent table Updating the Primary Key of a Parent Table and Pushing the Change to the Database In this section you'll learn what happens if you attempt to update the primary ... DataRelation was created are • • Cascade, meaning that changes to the CustomerID DataColumn of customersDT are cascaded to ordersDT This is the default None, meaning that changes to the CustomerID DataColumn...

6
428
0

Tài liệu The Anatomy of a Large-Scale Hypertextual Web Search Engine ppt

Ngày tải lên : 24/01/2014, 20:20

... searching as long as there are not that many anchors for a particular word We expect to update the way that anchor hits are stored to allow for greater resolution in the position and docIDhash ... And, the d damping factor is the probability at each page the "random surfer" will get bored and request another random page One important variation is to only add the damping factor d to a single ... extensions to PageRank, again see [Page 98] Another intuitive justification is that a page can have a high PageRank if there are many pages that point to it, or if there are some pages that point to...

20
571
0

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Ngày tải lên : 18/02/2014, 08:20

... strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that ﬁnally leads to the supercomplex formation ... Standard procedures were used for the preparation and ligation of DNA fragments, for the transformation of Escherichia coli and for the isolation of plasmid DNA from bacterial cells [51] Other ... immediately after the addition of the ISP to the bc1 sub-complex, a shift in the molecular mass from approximately 500 to 670 kDa occurs This change in the molecular mass is too large to be explained...

15
639
0

Tài liệu SCRIBE: The design of a large-scale event notiﬁcation infrastructure? doc

Ngày tải lên : 19/02/2014, 18:20

... tree are called forwarders with respect to the topic; they may or may not be subscribers to the topic Each forwarder maintains a children table for the topic containing an entry (IP address and ... creation and maintenance algorithms assume that all group members know about each other and, therefore, not scale to large groups Scribe builds a multicast tree on top of a Pastry network, and ... and adds the source node as a child in the associated children table It then becomes a forwarder for the topic by sending a SUBSCRIBE message to the next node along the route from the original...

13
631
0

Báo cáo khoa học: Binding of cGMP to the transducin-activated cGMP phosphodiesterase, PDE6, initiates a large conformational change involved in its deactivation ppt

Ngày tải lên : 06/03/2014, 00:21

... changes its conformation, particularly that of its noncatalytic site and ⁄ or a region(s) near the noncatalytic site, and that Pabc, after changing its conformation, ﬁrmly holds the [3H]cGMP A ... to Pabc during preincubation is the sole reason for the increase in the ﬁlter-trapping level of [3H]cGMP-bound Pabc, i.e the increase appears to be caused by a conformational change in Pabc upon ... bound to Pabc, is not dissociated (Fig 5A) Rate of the conformational change in Pabc The level of [3H]cGMP-binding increased abruptly after a 10-min incubation (Fig 5A) The level was increased approximately...

19
406
1

Review of the Need for a Large- scale Test Facility for Research on the Effects of Extreme Winds on Structures pptx

Ngày tải lên : 08/03/2014, 19:20

... science and technology and to their use for the general welfare Upon the authority of the charter granted to it by the Congress in 1863, the Academy has a mandate that requires it to advise the federal ... given to the National Academy of Sciences by its congressional charter to be an adviser to the federal government and, upon its own initiative, to identify issues of medical care, research, and ... Finally there is no guarantee that federal funds would be made available on an ongoing basis to support research at an LSWTF even if a national wind-hazard reduction program were established The...

49
588
0

Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc

Ngày tải lên : 16/03/2014, 23:20

... indicates Cyanophora paradoxa (Cp, a Glaucocystophyte) and red Cyanidioschyzon merolae (Cm, a Rhodophyte) The brown color indicates Guillardia theta (Gt, a Cryptophyte) and Thalassiosira pseudonana (Tp, ... pseudonana (Tp, a Diatom) The Viridiplantae (green, of a lighter shade for chloroplast genes) are Arabidopsis thaliana (At), Chlamydomonas reinhardtii (Cr), Chlorella vulgaris (Cv), Nicotiana tabaccum ... (http://www.jgi.doe gov/) We thank the Kazusa Institute and the Chlamydomonas Genome Project for EST data and ´ cDNA material, and H Moreau (Observatoire Oceanologique de Banyuls, France) for granting us access...

14
436
0

A BOATER’S GUIDE TO THE FEDERAL REQUIREMENTS FOR RECREATIONAL BOATS AND SAFETY TIPS potx

Ngày tải lên : 17/03/2014, 14:20

... Atmospheric Administration’s National Ocean Service (NOS) produces a NN N variety of nautical charts and related products Nautical charts can vary in scale and format Chart scale refers to a measurement of an area, not the distance A chart covering a relatively large area is called a “small scale” ... A chart covering a relatively large area is called a “small scale” chart; a large scale” chart will cover a relatively small area and show much greater detail Having the most current chart is important That is why the publication date is critical ... Lateral Aids Information and Regulatory Markers Lateral aids marking the sides of channels, as seen when entering from These orange-and-white Aids are used to alert vessel operators seaward to various warnings and regulations...

45
515
0