what is a synonym for allegedly

... ILLUSTRATOR BRIAN P. CLEARY is the author of the Words Are Categorical series, including A Mink, a Fink, a Skating Rink: What Is a Noun? and Hairy, Scary, Ordinary: What Is an Adjective?, and of Rainbow ... what is a synonym? / by Brian P. Cleary; illustrated by Brian Gable. p. cm. — (Words are categorical) eISBN: 1-57505-907-X 1. English language—Synonyms and antonyms—Juvenile literature. I. Gable, Brian, ... agree that it’s pre tty appealing, we have all these choices to say how we’re feeling? comprehend and grasp and know. Richness and depth are what synonyms raise when they’re used in a paragraph,...

Ngày tải lên: 02/03/2014, 04:25

Ngày tải lên: 19/06/2014, 08:20

Ngày tải lên: 26/06/2014, 23:20

... necessary? - What is the purpose of the form? - Does a form with a similar function already exist, or can this new form be combined with an existing form? - Does the form have a name, and is this name as ... inspiration or for the evaluation and selection of image material. Ambience The Heineken organisation's key values are an essential starting point for image manipulation and photography. ... frontages and company vehicles. Why have a Company Visual Identity? A Company Visual Identity gives an organisation its own look. It make s a company recognisable, to the outside world and also...

Ngày tải lên: 23/10/2012, 13:53

... frequently. Project management is a relatively recent approach to management. It is a particularly effective approach to gaining management control, and enables a focus on use of resources to gain specific ... from a project management approach) and the subsequent process of ensuring that appropriate data is entered into the system and used for management, which is part of normal routine activity. Managing ... requirement that students should demonstrate that they can review the results and provide a critical evaluation of what was achieved and what was learnt from the project. ACHIEVING OUTCOMES Unfortunately,...

Ngày tải lên: 24/10/2013, 08:20

... standard, accepted, and well-understood protocol called HTTP to transmit data, and a portable data format that is based on XML. HTTP and XML are both standardized technologies that can be used ... values, and for describing the types of parameters and return values. When a client calls a Web service, it must specify the method and parameters by using this XML grammar. SOAP is an industry ... for a Web service in a mechanical manner, and then use it to create a proxy object that a client can use to convert method calls into SOAP requests. You will do this later in this chapter. For...

Ngày tải lên: 15/12/2013, 00:15

... magnetized or demagnetized. The machine is capable of storing and manipulating numbers, letters, and characters. The basic idea of a computer is that we can make the machine do what we want ... computer can be defined as devices (thiết bị?) which(2) ( !devices) accept information in the form of instructions called a program and characters called data, perform mathematical and/or logical ... mathematical and/or logical operations then supply new information. 2. All computers have three basic capabilities. 3. A computer is a machine that can be made to operate by receiving signals. 4. A...

Ngày tải lên: 21/12/2013, 20:15

... http_proxy /usr/etc/httpd -r /etc/inner-proxy.conf -p 8081 This is a little ugly, so there are also the following directives in the configuration file: http_proxy http://outer.proxy.server/ ftp_proxy ... http://outer.proxy.server/ ftp_proxy http://outer.proxy.server/ gopher_proxy http://outer.proxy.server/ wais_proxy http://outer.proxy.server/   ...

Ngày tải lên: 23/12/2013, 19:15

... non - - displaced displaced What is a Salter What is a Salter - - Harris fracture? Harris fracture?   Fracture through growth plate in a pediatric Fracture through growth plate in a pediatric patient patient   35 ... Growth   Cartilage growth from epiphysis towards Cartilage growth from epiphysis towards metaphysis metaphysis   Neovascularization Neovascularization and primary bone formation and primary bone formation ... epiphysis, Fracture through epiphysis, physis physis , and , and metaphysis metaphysis   Also chronic disability because of Also chronic disability because of articular articular surface...

Ngày tải lên: 25/01/2014, 06:24

... our data. Many times in our applications we must execute some type of mathematical formula on our data. It's a rare occurrence when our data is actually exactly what we needed. As an example, ... display the value inside a counter for the machine operator at all times (for example). Timers Let's now see how a timer works. What is a timer? Its exactly what the word says it is an ... each and every scan. Sometimes this is a good thing (for example if we are acquiring data from an A/ D module) but other times it's not (for example an external display would be unreadable...

Ngày tải lên: 18/02/2014, 23:20

... Associated Schools (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar ... Curriculum and assessment Authority (VCAA) manages and awards school qualifications. It administers and awards two senior school secondary qualifications known as the Victorian Certificate of education ... and students with a language background other than English. The average ICSEA value is 1000 and the lower the value the more disadvantaged is the school. Table 5: Comparisons across Secondary...

Ngày tải lên: 20/02/2014, 19:20

... between the axle and the chassis is called the bearing. A plain bearing can be as simple as an axle turning in a drilled hole. A bushing is a smooth sleeve placed in a hole that gives the axle a smother rubbing ... mousetrap car is affected by two type of friction: airfriction and bearing friction. Airfriction is a large factor only with cars that are moving fast and is nearly negligible for slow-moving distance ... two forces: the force of gravity pulling straight down and the normal force of the ramp pushing back (Formula #4). As the angle of the ramp is increased, the normal force decreases (Formula #5)....

Ngày tải lên: 16/03/2014, 12:20

... 11444–11455. 12 Ozaki T, Watanabe K-I, Nakagawa T, Miyazaki K, Takahashi M & Nakagawara A (2003) Function of p73, D. O. Passos et al. Functional association of Ki-1 ⁄ 57 and PRMT1 FEBS Journal 273 (2006) ... sulfate, heparan sulfate and RNA, although with lower affinity, it was also named intracellular hyaluronan binding protein 4 (IHABP4) Keywords cellular localization; mapping; post-translational ... of LexA DNA-binding domain. Recombinant plasmids were transfected in Saccharomyces cerevisiae strain L40. A human fetal brain cDNA library (Clontech, Palo Alto, CA) expres- sing GAL4 activation...

Ngày tải lên: 16/03/2014, 13:20

... Ala, mutagenic primers, 5 0 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA-3 0 or 5 0 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA-3 0 (corre- sponding to amino-acid residues 264–277), were used for PCR amplification. Immunoprecipitation, ... two-dimensional phosphoamino-acid analysis, as shown in the bottom panels. Radioactive phosphopeptides were visualized with FLA 2000 Bioimage Analyzer after five-day exposure (4 and 5), 10-day exposure ... (Fig. 5). Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that would allow it to be a substrate by cyclin/cdk3 as well as cyclin/cdk2...

Ngày tải lên: 24/03/2014, 04:21

... Điều này xảy ra như thế nào? Mua cam và chip máy nh Giả sử một gia đình – Robert, Maria và hai đ a con – đi mua đồ ăn cho b a tối. Họ có thể dự định mua thịt gà, cà chua và cam; nhưng ... nâng cao học vấn c a anh ta là Robert trở thành một thành viên hữu ích và được đào tạo cao hơn trong cộng đồng c a anh. Anh ta hiện giờ có những kỹ năng mới và đã xây dựng được một doanh nghiệp ... mở rộng kinh doanh, phân chia rủi ro và lợi nhuận; quyền tự do c a người lao động trong việc l a chọn công việc hoặc nghề nghiệp, tham gia vào nghiệp đoàn lao động hoặc thay đổi chủ. Đó...

Ngày tải lên: 24/03/2014, 06:20

... HPNAP_up (5Â-GCGGAA TTC CATATGAAAACATTTGAAATT-3Â) and HPNAP_ low (5Â-GCG GGATCCTTAAGCCAAATGGGCTTG-3Â), HPNAP_up (5Â-GCG GAATTCCATATGAAAACATTTG AAATT-3Â) and HPNAP_low (5Â-CCG CTCGAGAGCC AAATGGG-3Â), ... (5Â-GCG GAATTCCATATGAAAA CATTTGAAATT-3Â) and HPNAP 157-low (5Â-CCG CTC GAGCCTTTCAGCGA-3Â) (XhoI), and HPNAP 58144- up (5Â-GCG GAATTCCATATGATCGTTCAATTAGGA- 3Â)(EcoRI, NdeI) and HPNAP 58144-low (5Â-CCG CTC GAGAGCCAAATGGG-3Â), ... 5Â-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3Â,5Â-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3Â, 5Â-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3Â and 5Â-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3Â for H2 5A, H3 7A, D5 2A and K13 4A, respectively. The PCR products were puri- fied, cloned into pET1 1a, and...

Ngày tải lên: 30/03/2014, 04:20

... warmer climates are not entirely exempt from such worries, however: certain soils will expand and contract when moisture is added or taken away, and engineers must factor in such ... added or taken away, and engineers must factor in such movement when considering where and how to lay a foundation. ...

Ngày tải lên: 07/06/2014, 11:44

Ngày tải lên: 10/06/2014, 22:35

Ngày tải lên: 18/06/2014, 20:20

Ngày tải lên: 11/07/2014, 13:14