... neurons in the ventral tegmental area (VTA) allows them to release dopamine in the NAc and (via amygdala) in certain parts of the hippocampus, permitting the completion of the cascade and the development ... release at the NAc Gabapentin is a gamma-aminobutyric acid (GABA) analogue, with GABAmimetic pharmacological properties Gabapentin is used for the treatment of seizures, anxiety and neuropathic ... increase (approximately 50%, p < 0.05) in extracellular NAc GABA levels, but failed to alter either basal or cocaine-enhanced NAc DA These data suggest that Gabapentin is a weak GABA-mimic drug At the
Ngày tải lên: 13/08/2014, 16:21
... This led to a dramatic increase in the number of candidates in the battle to succeed Romano Prodi and a linking of the nomination of a candidate to the majority in the newly elected European Parliament ... remains a largely intergovernmental organization, decisions in the European Council and the Council of Ministers are as accountable to national citizens as decisions of national cabinets In other ... when drafting or implementing legislation, are much more isolated from national parliamentary scrutiny and control than are national cabinet ministers or bureaucrats in the domestic policy-making
Ngày tải lên: 17/10/2022, 22:54
Learners’ Beliefs as Mediators of What Is Noticed and Learned in the Language
... Learners’ Beliefs as Mediators of What Is Noticed and Learned in the Language Classroom EVA KARTCHAVA AND AHLEM AMMAR Universit e de Montr e al Montr e al, Canada The goal of this study was ... corrective feedback Paper presented at EFFECTS OF LEARNER BELIEFS IN LANGUAGE LEARNING 105 the annual conference of American Association of Applied Linguistics, Atlanta, GA Ammar, A. , & Spada, N (2006) ... feedback and L2 learning, noticeability of feedback, and individual differences Eva has been appointed as an Assistant Professor (Applied Linguistics and Discourse Studies) in the School of Linguistics
Ngày tải lên: 22/10/2022, 19:36
Learners’ Beliefs as Mediators of What Is Noticed and Learned in the Language
... Learners’ Beliefs as Mediators of What Is Noticed and Learned in the Language Classroom EVA KARTCHAVA AND AHLEM AMMAR Universit e de Montr e al Montr e al, Canada The goal of this study was ... corrective feedback Paper presented at EFFECTS OF LEARNER BELIEFS IN LANGUAGE LEARNING 105 the annual conference of American Association of Applied Linguistics, Atlanta, GA Ammar, A. , & Spada, N (2006) ... feedback and L2 learning, noticeability of feedback, and individual differences Eva has been appointed as an Assistant Professor (Applied Linguistics and Discourse Studies) in the School of Linguistics
Ngày tải lên: 23/10/2022, 01:01
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... be static, assisting the reliable calculations of the total amount of CaCl2 added What is apparent from Fig 1A, B is that both ADP and ATP significantly decreased Ca2+ uptake rates as compared ... connection – if any – to the type of ANT expressed in A franciscana been established In the present study, the most important finding is that A franciscana ANT has a stretch of amino acids in the 198–225 ... homologs of A franciscana ANT were those expressed in Drosophila melanogaster and Xenopus laevis, both of which are similar to each other but not to A franciscana ANT regarding the 198–225 amino acid
Ngày tải lên: 29/03/2014, 00:20
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... MADS box at their N-termini and within an adjacent 29-amino-acid region referred to as the MEF2 domain. The MADS box is essential for DNA binding and dimerization, and the MEF2 domain plays an ... cells throughout the brain lobes and at the midline in the subesophageal ganglion (SG) (Fig. 1A) . The axons emanating from the somata of the two pairs of lateral cells extend towards the pars intercerebral ... for the entire somata (S) of the brain. Fluorescence images were converted to grayscale and inverted into black and white images. An area adjacent to the area of interest (A) and an area from an
Ngày tải lên: 30/03/2014, 20:20
def (digestive organ expansion factor) is a crucial gene for the development of endoderm derived organs in zebrafish (danio rerio
... element, an Ac-like element from the Japanese medaka fish, and its transposition in the zebrafish germ lineage. Proc Natl Acad Sci U S A 97, 1140311408. Kawakami, K., Takeda, H., Kawakami, N., Kobayashi, ... Duan et al., 1993; Falk et al., 1994) These data suggests that the intestinal anlage holds all necessary information for correct patterning of the small intestine along the A- P axis ... contains mutations in all zebrafish genes, just as the T-DNA insertion line collection in Arabidopsis That means any desired mutant could be directly obtained from a library containing all
Ngày tải lên: 11/09/2015, 16:06
What is a FOIL in literature
... noticeable about the two characters? FOIL in Math First Outer Inner Last What INNER characteristic is most noticeable about the two characters? What is the LAST thing that you notice about the ... differs drastically How is a FOIL in math and a FOIL in Literature the same? FOIL in Literature What is the FIRST thing you first notice about the two characters? What OUTER characteristic is most ... Foil in The Outsiders? Anne Frank Who is the FOIL in Anne Frank? Margot Frank Edward Who is the FOI L in Twilight? Jacob Cinderella Who is the FOIL to Cinderella? Step Sisters Katniss Peeta Who is
Ngày tải lên: 01/12/2016, 22:44
Extracorporeal shockwave therapy enhances expression of Pdia-3 which is a key factor of the 1α,25-dihydroxyvitamin D 3 rapid membrane signaling pathway in treatment of early osteoarthritis
... (5′–3′) GAGGCTTGCCCCTGAGTATG GTTGGCAGTGCAATCCACC AGCTGCTAAAGAGCCAGCAG GCAAGGCCAAAATCACAGAT GTTCTTGCACAGCTTCACCA AAACAGCCCAGTGACCATTC GACAAGAAGCCCTTCACAGC Reverse 20-mer GGGGGATGTAGTTCTGCTCA Forward ... GAGGTGAAAAGGCTCAGTGC TGGGCCCATTGAAAAAGTAG Immunohistochemistry Sections were hybridized with relative antibodies against candidate proteins and analyzed using a streptavidin conjugated horseradish ... using responsive molecules and rat 18S rRNA primers (forward: 5’-GCAGCTAGGAATAATGGAATAGGA-3’; reverse: 5’-TAATGAAAACATTCTTGGCAAATG-3’) The number of amplification steps required to reach an arbitrary
Ngày tải lên: 15/01/2020, 14:55
Positive Darwinian selection is a driving force for the diversification of terpenoid biosynthesis in the genus Oryza
... Hierarchical clustering analysis was performed in MATLAB using the clustergram function in the bioinformatics toolbox The Mahalanobis Distance was used to calculate the distance matrix, from which the ... Nature 2006, 440:1078–1082 34 Sakai H, Ikawa H, Tanaka T, Numa H, Minami H, Fujisawa M, Shibata M, Kurita K, Kikuta A, Hamada M, Kanamori H, Namiki N, Wu J, Itoh T, Matsumoto T, Sasaki T: Distinct ... DAS may be adaptive, likely in the attraction of the natural enemies of insect herbivores This study gains us further insight into the mechanisms shaping the diversity of plant secondary metabolism
Ngày tải lên: 27/05/2020, 01:14
ADAM12-L is a direct target of the miR-29 and miR-200 families in breast cancer
... were 5′-AGC CAC ACC AGG ATA GAG AC-3′ (F) and 5′-CGC CTT GAG TGA CAC TAC AG-3′ (R) The primers used for the ADAM12-S analysis were 5′TCC ATC CAA GCA AAC TGA AT-3′ (F) and 5′-GTT GGT GAC TCT GTG GGT ... Zolkiewska A Breast cancer-associated mutations in metalloprotease disintegrin ADAM12 interfere with the intracellular trafficking and processing of the protein Int J Cancer 2008;122:2634–40 Stautz ... cancer Sara Duhachek-Muggy and Anna Zolkiewska* Abstract Background: ADAM12-L and ADAM12-S represent two major splice variants of human metalloproteinase-disintegrin 12 mRNA, which differ in their
Ngày tải lên: 30/09/2020, 12:52
Decreased expression of Yes-associated protein is associated with outcome in the luminal A breast cancer subgroup and with an impaired tamoxifen response
... signature [37] Further details of the datasets included in the analysis can be found in references [38-43] The aCGH (array Comparative Genomic Hybridisation) patient data set consisted of 171 patients ... immunohistochemical staining and scoring of YAP1 expression Tumours from the screening and randomised cohorts were assembled in tissue microarrays using a manual tissue arrayer (MTA-1; BeecherInstruments, ... for maintaining the negative relationship This was despite the fact that CCND1 amplified cases were associated with a stronger cyclin D1 expression in this material (data not shown) The inverse
Ngày tải lên: 05/11/2020, 01:20
adverb clause adverb clause what is an adverb what is a clause what is an adverb clause what is an adverb it is a word that describes or adds to the meaning of a verb an adjective and another adv
... (1)Adverb Clause What is an Adverb? What is a Clause? (2 )What is an Adverb? (3 )What is a Clause? It is a group of words which form a grammatical unit and which contain a subject and a finite ... verb A clause (4 )What is an Adverb Clause? A group of words which contains a subject and a finite verb that describes or adds to the meaning of a verb, an adjective and another (5)(6)1 Adverb ... are introduced by (10)2 Adverb Clause of Reason I was late because I could not catch the bus Since I was late, I took a taxi The manager dismissed Mary, for she was very lazy As the
Ngày tải lên: 10/04/2021, 05:54
slide 1 answer the questions about hoa what time do her classes start and finish how many hours a day does she do her homework what does she often do in the summer holiday her classes start at 7 an
... (Independence day), Thanksgiving and Christmas. (24)(25 )What is the longest vacation in the U S. ?The longest vacation in the U S is summer vacation. (26 )What does Tim usually in the vacations? ... writes the letter? Tim writes the letter (21)(22)How many vacations American students have? They have vacations. (23 )What are the vacations? They’re summer vacation, New Year, Easter, ... -How many vacations in a year -Name the vacations -Which is the longest… (33)Compare the vacations stdents in VN and in USA have - Read the text again. - Learn the words.
Ngày tải lên: 20/04/2021, 06:00
To what extent is privacy legislation reflected in the university libraries privacy policies in new zealand
... point out that the Library & Information Association of New Zealand Aotearoa (LIANZA, 1978), the American Library Association (ALA, 1995), the Canadian Library Association (CLA, 1976) and the ... privacy principles as applying to all personal information Personal information therefore is considered widely as “information about an identifiable individual” In the United States, privacy has ... regulations This is a critical issue internationally and nationally in order to protect a fundamental human right, to adhere to the national legislation and to monitor the technology impacts in the university
Ngày tải lên: 14/09/2021, 20:44
Curriculum and Resource Guide Essential Question What transitions and challenges are experienced by immigrants along their journey of creating a new life in the U.S.
... (ATIS) of General MacArthur's headquarters in Australia, Manila and Japan Assisted in negotiating the surrender of Japanese troops in Manila Managed the Dai Ichi Hotel in Tokyo for headquarters ... How they feel about it? • What happens along the way? Are there any obstacles? • What happens on arrival in the U.S.? Are there are surprises? How they feel about it? • How they go about creating ... through the eyes of a 10-yearold boy Several of the incarcerated Japanese Americans put together a baseball diamond, and when the boy channels his anger in a baseball game, he hits a home run Grades
Ngày tải lên: 18/10/2022, 22:27
‘Ethnographic’ Thematic Phenomenography – a methodological adaptation for the study of information literacy in an ontologically complex workplace
... are analysed in light of the interview data to contextualise that data and facilitate a workplace-wide analysis of information literacy and the information culture it creates Originality/value Insights ... An analysis and description of the value and validity of a ‘qualitative mixed methods’ approach in which the thematic form of phenomenography is contextualised ethnographically Findings This paper ... community Thematic analysis is undertaken on the understanding that behaviour can’t be absolutely abstracted, while recognising the researcher as a potential source of ‘bias’ and ‘contamination’ (O’Reilly,
Ngày tải lên: 04/11/2022, 07:44
interconnection of post transcriptional regulation the rna binding protein hfq is a novel target of the lon protease in pseudomonas aeruginosa
... proteases, Lon is a homo-oligomer consisting of an N-terminal domain, an ATP-binding domain, a substrate sensor and discriminatory domain, and a proteolytically active C-terminal domain within the ... and the capsule transcriptional activator RcsA7 Recent studies indicate that the Lon protease also plays an important role in the Gram-negative bacterium Pseudomonas aeruginosa This microorganism ... Transcription, RNA processing degradation 2.3 Conserved hypothetical protein Hypothetical 2.6 Aspartate ammonia-lyase Amino acid biosynthesis 4.4 leuD PA4063 PA4236 katA PA4333 PA4385 groEL PA4944
Ngày tải lên: 04/12/2022, 14:59
What is a Company Visual Identity?
... Visual Identity for Heineken Internationalisation and globalisation demand a clear picture of our organisation. It is in order to increase the familiarity of Heineken, reinforce our image and ... But there is a clear difference and should always be aware to apply the appropriate visual identity: Visual Brand Identity The green bottle with racetrack label is the origin of the brand’s visual ... meanings. The Heineken company and the Heineken brand. In the early days the two were almost one, the Heineken family founded a brewing company that brewed a great beer. Everything carried the...
Ngày tải lên: 23/10/2012, 13:53
What is a project
... something that is not part of ordinary day-to-day work. It also indicates something that is purposeful and distinct in character. In this chapter we consider how to dis- tinguish a project from other ... organizations, par- ticularly those without large numbers of staff, do not have an HR department but manage their staff within their general management structures. Again, the approaches to training, ... as part of educational courses because they give an opportunity for students to demonstrate that they can apply the course concepts and ideas in an integrated way in a real situation. It is also...
Ngày tải lên: 24/10/2013, 08:20