... of rural area: "'Rural areas' are considered to be those areas which are not urban in nature. An 'urban agglomer- ation' refers to the de facto population contained within the ... Foundation Concepts of Research on Migration Potential (A migrációs potenciál kutatásának alapfogalmai). In To Go or To Stay? Preference Act and the Migration Expectations (Menni vagy maradni? ... physicians varies at county level (Table 1). The uneven distribution of trained professionals between urban and rural areas is a serious problem in Hungary. Areas that lack doctors can only attract...
Ngày tải lên: 18/06/2014, 17:20
... approved before the working group meeting took place (f) b + f: explanation could be both a barrier and a facilitator b: explanation of a barrier f: explanation of a facilitator Driessen et al. ... ver- sion 5.2) was u sed to electronically code and man age data, and to generate report s of coded text for analysis. To illustrate the meaning of the perceived barriers and facilitators, quotations ... three factors appeared to be perceived as both a barrier and facilitator. The three fac- tors were ‘management commitment,’‘resources,’ and ‘collaboration.’ Management commitment The factor ‘management...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo Y học: A chimeric scorpion a-toxin displays de novo electrophysiological properties similar to those of a-like toxins docx
... turn of a scorpion a- neurotoxin. That result provides a second example of how a structural deviation can be associated to a particular functional topography. It also emphasizes the unique analytical ... corresponding sequences in LqhaIT were performed using the following oligonucleotides: 5Â-GGTTA TATTGCCAAGAACTATAACTGTGCATAC-3Â,5Â-C ATTGTTTAAAAATCTCCTCAGGCTGCGACACTTT A- 3Â,and5Â-ACGAGTGGCCACTGCGGACATAAATC TGGACACGGAAGTGCCTGCTGG-3Â, ... to a slight prolongation of AP duration and a AP amplitude decrease. An artificial repolarization (AR) does not restitute the initial AP (B). (C,D) Voltage-clamp experiments: cock- roach axonal...
Ngày tải lên: 08/03/2014, 23:20
Output of a Seminar on Energy Conservation in Paper and Pulp Industry pot
... refiner A conical type refiner consists of a conical fixed shell and a conical rotor with bars on the surface of the rotor. Drum type refiner A drum type refiner consists of a drum rotor and a stator. Most ... unit water consumption and head box temperature Unit water consumption (ton/paper ton) 1960 1990 175 87 Head box temperature (°C) 20 45 Paper machine unit steam consumption (ton/paper ton) 3.6 2.8 It ... beater before 30 years. After that, a larger capacity and labor saving requirement of a paper making machine follows a continuous beating machine, that is a rifiner. The types of a refiner are...
Ngày tải lên: 09/03/2014, 00:20
What is the price of a mousetrap? The assessment of value from cloud services pptx
... solution. The latter has the additional attributes of being available anywhere, at anytime and on any device. If it was only a simple as a mouse-trap. The complication is that for most customers ... the traditional performance measure are absurd. It is pure guesswork to forecast IT demand over a multi-year period and translate that back to IT costs. How many and what types of servers are ... corporation Conclusion In this ebook, I discuss one functional transformation that has taken placed as a result of cloud services, namely; the impact on the assessment of value. This is a timely...
Ngày tải lên: 09/03/2014, 02:20
Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx
... measured as a change in the capacitance of a plane capacitor.An approach for the detector array based on the stress induced on a thin Contacts Si membrane SiO 2 Cavity Substrate Protein acceptor (a) Protein (b) Figure ... milliseconds Standard deviation calculation for one muta- tion (using a HW core-accelerator) 0.36 microseconds Standard deviation calculation for the entire array (using a HW core-accelerator) 3.06 ... biological material on different locations so as to avoid microarray area variability side effects. In addition, the computations for the mean values calculations for each of the genes may start just as...
Ngày tải lên: 21/06/2014, 22:20
Cutting Tool Materials What is the use of a book docx
... re- viewed. .. Rationalisation In order to be able to rationalise the tools within the current production facility, it is essential to conduct a thorough appraisal of all the tools and associated equipment ... slippery and friable. HBN can be transformed in a similar fashion to that of CBN (Fig. 12 bii). In practice, to facilitate the rate of transformation in the reaction chamber, additions of solvents/catalysts ... uncomplicated tooling database for later in- terrogation. Having established the current status of the tool- ing within the manufacturing facility, this allows for a tooling rationalisation campaign...
Ngày tải lên: 27/06/2014, 23:20
Báo cáo toán học: "A proof of a theorem on trace representation of strongly positive linear functionals on $OP*-algebras$ " pdf
...
Ngày tải lên: 05/08/2014, 09:46
Báo cáo y học: "Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes" ppsx
... A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, ... Mabuchi A, Sekine A, Saito S, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: An intronic SNP in a RUNX1 binding site of SLC2 2A4 , encoding an organic cation transporter, is associated with rheumatoid ... Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deimi- nase 4, are associated with...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Dissection of a locus on mouse chromosome 5 reveals arthritis promoting and inhibitory genes" doc
... Y, Sawada T, Suzuki M, Nagasaki M, Ohtsuki M, Ono M, Furukawa H, Nagashima M, Yoshino S, Mabuchi A, Sekine A, Saito S, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: An intronic SNP in a RUNX1 ... R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes ... phosphatase (PTPN22) is associated with rheumatoid arthritis. Am J Hum Genet 2004, 75:330-337. 3. Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: "Sudden massive neck swelling due to hemorrhage of a thyroid adenoma: a case report" docx
Ngày tải lên: 10/08/2014, 23:20
Báo cáo y học: " “Coercion Experience Scale” (CES) - validation of a questionnaire on coercive measures" docx
Ngày tải lên: 11/08/2014, 16:22
báo cáo khoa học:" Development and validation of a questionnaire on ‘Satisfaction with dermatological treatment of hand eczema’ (DermaSat)" potx
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "The World Trade Center Attack Eye witness: observations of a physician on the outside looking in" potx
Ngày tải lên: 12/08/2014, 18:21
A study on the techniques for the improvement to the teaching of oral skills in light of communicative english language teaching for junior high school teachers in quang ngai province part 1
... language teaching. 1 • The Functional-Notional Approach In the 1970s teachers of the Functional-Notional Approach stopped teaching grammar and started teaching more practical phrases and vocabulary ... play, etc. 1.3. Communicative Language Teaching 1.3.1. Definition According to American and British proponents, Communicative Language Teaching is an approach that aims to (a) make communicative ... POINTS: ã Mistakes are not bad. ã They are natural and unavoidable part of learning a language. ã They are useful. They show the teacher what their students have and have not learnt. 32 30-34 years ...
Ngày tải lên: 07/11/2012, 14:41
A study on the techniques for the improvement to the teaching of oral skills in light of communicative english language teaching for junior high school teachers in quang ngai province part 3
... support. I am sincerely grateful to Mr. Đinh Tấn Bảo and my colleagues of Foreign Languages Department, Quang Ngai Teachers Training College for their attention and encouragement. I am appreciative of ... ACKNOWLEDGEMENTS First of all, I would like to express my deep gratitude to all my teachers at College of Foreign Languages, Vietnam National University-Hanoi for their valuable lectures. And ... experience and training 9 ã Qualifications 10 2.6.2.2. Information about Schools 10 ã Access to resource at school 10 ã Conditions that facilitate teaching 10 ã Conditions that impede teaching 11 ...
Ngày tải lên: 07/11/2012, 14:41
A study on teaching oral skills to the first year students at Hanoi University of Industry in the Communicative Approach
... information gap between the speaker and the hearer; making a choice from his repertoire of language of what to say and how to say it; and evaluating feedback from what he has done. Information gap ... CLT as in the situations in Korean, Indonesian and Japanese context. HaUI teachers' opinions about the traditional grammar based exams as a difficulty and their priority of training in assessing ... Li, are related to educational values and attitudes, reading, oral skills, grammar, students' attitudes, teachers' attitudes, pre-service teacher education, and local educational growth....
Ngày tải lên: 07/11/2012, 15:01
A study on some major factors affecting English learning of grade 6 ethnic minority students of a mountainous secondary school to help them learn better
... motivation may be constructed as: a state of cognitive and emotional arousal which leads to a conscious decision to act and gives rise to a period of sustained intellectual and/or physical effort ... strategies, attitudes and motivation as well as environment and context of learning. 2.2. Definitions of language acquisition “Language acquisition is one of the most impressive and fascinating ... teaching and learning situations, learners’ motivation and attitudes towards the target language reveal to have less important effect than the factors mentioned above in this study. The data...
Ngày tải lên: 07/11/2012, 15:04