what can you do with a microdrop

Báo cáo bài tập lớn tìm hiểu virus trojan house

... Software \ Mirabilis \ ICQ \ Agent\ Apps\] +Trong ActiveX: [HKEY_LOCAL_MACHINE \ Software \ Microsoft \ Active Setup \ Installed Components \ KeyName] StubPath=c:\ \Trojan.exe - Loại bỏ Trojan ta ... credit card thông tin khác hang • Tìm kiếm thông tin account liệu bí mật • Danh sách đ a email, đ a nhà riêng • Account Passwords hay tất cae thông tin vệ công ty TRƯỜNG CAO ĐĂNG BÁCH KHOA HƯNG ... nhiềunămsauđó Vào năm 1989 virus AIDS Trojan Xuất AIDS Trojan hay gọi ng a TRƯỜNG CAO ĐĂNG BÁCH KHOA HƯNG YÊN!!!!! BÁO CÁO BÀI TẬP LỚN TÌM HIỂU VIRUS TROJAN HOUSE thành Tơ Roa, chúng la virus...

30
1,046
19

Báo cáo virus học bệnh đầu vàng ở tôm sú ppt

Danh mục: Ngư nghiệp

... gặp 50-70 ngày ao nuôi tôm sú thâm canh  Tôm bị nhiễm virus YHV  Thường xảy tháng nuôi 1-2  Xảy ao nuôi có mật độ cao (thâm canh)  Xảy ao có ô nhiễm hữu  Trong ao có độ cao  Ao tích luỹ nhiều ... người ta cho YHV virus thuộc họ Coronaviridae (theo V Alday de Graindorge & T.W Flegel, 1999)  Những nghiên cứu Úc cho YHV có liên quan với số loại virus khác, loại virus liên quan tới mang tôm ... Môi trường ao không ổn định IV CƠ QUAN CẢM NHIỄM YHV công vào quan lymphoid, mang cá haemolymph, quan tạo máu, hồng cầu, tuyến gan, ruột, phiến mang, quan sinh dục, tuyến râu tôm ch a trưởng thành,...

26
1,179
6

Báo cáo y học: " Household exposure to pesticides and bladder exstrophy in a newborn baby boy: a case report and review of the literature" pps

Danh mục: Báo cáo khoa học

... congenital anomalies Cad Saude Publica 2002, 18:421-428 Ortega Garc a, JA, Ferrís i Tortajada J, López Andreu JA: Paediatric environmental health speciality units in Europe: integrating a missing ... was born after 38-weeks gestation via a cesarean section and had an Apgar score of 10/10; the amniotic fluid was clear and his birth weight was 6lbs The findings of the neonatal physical examination ... examination included BE with a rudimentary gland, normal anus and rectum, undescended testicles present in the inguinal canal and a normal scrotum No other abnormalities were found in chest, abdominal,...

4
339
0

Báo cáo y học: "Household environmental tobacco smoke and risks of asthma, wheeze and bronchitic symptoms among children in Taiwan" pps

Danh mục: Báo cáo khoa học

... Kurosaka F, Nakatani Y, Terada T, Tanaka A, Ikeuchi H, Hayakawa A, Konohana A, Oota K, Nishio H: Current cat ownership may be associated with the lower prevalence of atopic dermatitis, allergic ... for age, sex, parental education, parental history of asthma, parental history of atopy, gestational age, and community † Early-onset: asthma diagnosed ≦ yr of age ‡ Late-onset: asthma diagnosed ... if there was a positive answer to the question “Has a doctor ever diagnosed this child as having asthma?” Active asthma was defined as physician-diagnosed asthma with any asthma-related symptoms...

10
202
0

Báo cáo y học: "House dust mite major allergens Der p 1 and Der p 5 activate human airway-derived epithelial cells by protease-dependent and protease-independent mechanisms" docx

Danh mục: Báo cáo khoa học

... Ltd, Cardiff, UK) Total protease (using casein as a substrate), elastase (using N-succinyl-alanylalanyl-prolyl-leucine p-nitro-anilide as a substrate) and gelatinase (using gelatin-orange as a substrate) ... cells and keratinocytes, have shown an abundance of G-coupled signalling pathways that are triggered upon cleavage of Protease-activated receptors (PARs) [24] PARs are also present on epithelial ... accordance with previous findings, we showed that the HDM-derived protease Der p caused both damage and activation of airway epithelial cells Damage to epithelial cells may facilitate the passage of allergens...

8
214
0

Báo cáo y học: "Housekeeping genes tend to show reduced upstream sequence conservatio" pot

Danh mục: Báo cáo khoa học

... INT and HK HIF 1A Hypoxia inducible factor 1, alpha subunit; as AHR, it can interact with ARNT HK MYC and MAX Proto-oncogene protein c-myc and MYC associated factor X; they can form MYC:MAX heterodimers ... Promoters with no CpG islands correspond to classical TATA-containing promoters and it has been recently shown in a large-scale analysis that they are particularly wellconserved across different mammalian ... to assess differences between groups unless stated The R statistical package was used [44] The following additional data are available with the online version of this manuscript Additional data...

10
127
0

BÁO cáo VIRUS học đại CƯƠNG VIRUS gây BỆNH đốm TRẮNG TRÊN tôm (WSSV)

Danh mục: Sinh học

... *(Nguồn:http://krauthammerlab.med.yale.edu/imagefinder/Figure.external? sp=SPMC2873410%2Fpone.0010718.g011&state:Figure=BrO0ABXcRAAAAAQAACmRvY3VtZW 50SWRzcgARamF2YS5sYW5nLkludGVnZXIS4qCk94GHOAIAAUkABXZhbHVleHIAEGphdmEu ... Zhan ctv 1995 Thái Lan Đài Loan Thái Lan Woongteerasupaya ctv, 1995 Wang, 1995 Woogteerasupaya Trung Quốc Đài Loan Đài Loan ctv, 1995 Tapay ctv, 1996 Chang ctv,1996 Wang ctv,1996 Trung Quốc Yang ... cương Hình Cấu trúc nuclecapsis WSSV *(Nguồn:http://luanvan.co/luan-van/luan-van-xac-dinh-thanh-phan-protein-cua-virus-gay-hoi-chungdom-trang-white-spot-syndrome-virus-wssv-nhan-sinh-khoi-28595/ )...

29
1,118
0

Báo cáo sinh học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" potx

Danh mục: Hóa học - Dầu khí

... family Bunyaviridae Virology 1994, 198:196-204 Okumura M, Yoshimatsu K, Kumperasart S, Nakamura I, Ogino M, Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa ... SK, Vaheri A, Plyusnin A: L protein, the RNA-dependent RNA polymerase of hantaviruses Arch Virol 2005, 150:533-556 Chandy S, Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham ... similar to that of other hantaviruses, with approximate alignment of hydrophobic domains corresponding to signal peptide, and Gn and Gc transmembrane domains (data not shown) While most hantavirus...

5
406
0

Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf

Danh mục: Hóa học - Dầu khí

... seconds and 72°C for 30 seconds Data analysis The ΔΔCT [23] method was used for initial data analysis Four biological replicates were used for each infection and a two tailed test with a significance ... Genomics 2001, 7(2):97-104 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes Physiol Genomics ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have...

5
481
0

Báo cáo hóa học: " Thottapalayam virus is genetically distant to the rodent-borne hantaviruses, consistent with its isolation from the Asian house shrew (Suncus murinus)" pdf

Danh mục: Hóa học - Dầu khí

... family Bunyaviridae Virology 1994, 198:196-204 Okumura M, Yoshimatsu K, Kumperasart S, Nakamura I, Ogino M, Taruishi M, Sungdee A, Pattamadilok S, Ibrahim IN, Erlina S, Agui T, Yanagihara R, Arikawa ... SK, Vaheri A, Plyusnin A: L protein, the RNA-dependent RNA polymerase of hantaviruses Arch Virol 2005, 150:533-556 Chandy S, Mitra S, Sathish N, Vijayakumar TS, Abraham OC, Jesudason MV, Abraham ... similar to that of other hantaviruses, with approximate alignment of hydrophobic domains corresponding to signal peptide, and Gn and Gc transmembrane domains (data not shown) While most hantavirus...

5
316
0

Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot

Danh mục: Hóa học - Dầu khí

... seconds and 72°C for 30 seconds Data analysis The ΔΔCT [23] method was used for initial data analysis Four biological replicates were used for each infection and a two tailed test with a significance ... Genomics 2001, 7(2):97-104 Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M: Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes Physiol Genomics ... the assay to detect changes in the expression of genes of interest and may also produce artificial changes [3] Traditionally glyceraldehyde 3phosphate dehydrogenase (GAPDH) and β-actin (BACT) have...

5
574
0

Báo cáo hóa học: " Quantitative profiling of housekeeping and Epstein-Barr virus gene transcription in Burkitt lymphoma cell lines using an oligonucleotide microarray" docx

Danh mục: Hóa học - Dầu khí

... CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT TATCAAATTCAAGTGAAT TATCTTCGGAAGAACCCCAATTATGATCTCTAAGTGACCACCAGGGGCTCT GAACTGTAGCTGATGTTAT ATCATCGAGAAGGACAAAATCACCACCAGGACACTGAAGGCCCGAATGGA CTAACCCTGTTCCCAGAGCC ... TTTCCCAAGTCCCGCATCGTCCGCAGCTTGATGCCCTTCTCTCCGTACGAG CCCCTGAACTTCCACGCCA GCAAGAAGTTACGACACGTACACAACGACAGAACAACAGAGAAGACCCCG AAGACCACTAGCACGACCGT CGAAGGAAAGTGGAGCTCTTCATCGCCACCTCCCAGAAGTTTATCCAGGAG ACAGAGCTGAGCCAGCGCA CTCTCTCTTTCAGGCCTCAACAGGCACTGTATTCATTGCCAATGTTCCAAAT ... TCATCCAGACTTAGCCAC GCAACCACTGATACACTGGAAAGCACAACAGTTGGCACTTCTGTCTAGAAA ATAATAATTGCAAGTTGTA ACCTTGGCCATCTATGACCTGGCTACGCAGACTCTTAGGCATCAGTGTCAG CACCAGTCGGGCATCGTGC TTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCC...

15
426
0

Báo cáo y học: "Clinical importance and impact on the households of oseltamivir-resistant seasonal A/H1N1 influenza virus in healthy children in Italy" ppt

Danh mục: Báo cáo khoa học

... (0.05 μM); A/ H3-forward CCTTTTTG TTGAACGCA-GCAA (1 μM); A/ H3-reverse CGGATGAGGCAACTAGTGACCTA (1 μM); A/ H3-probe VICCCTACAGC-AACTGTTACCMG BNFQ (0.25 μM); B-forward TCACGAAAAATACGGT GGATTAAA (0.75 ... Emanuela Laicini (Milan, Italy); Andrea Papaleo and Luigi Cantarutti (Padua, Italy); Domenico De Mattia (Bari); Paolo Siani (Napoli); Ilaria Sala and Maria Cristina Diana (Genova) for their contribution ... 275-sequence AGTTGAATGCACCCAAT; N1 294sequence TGTGTGTATGCAGGGAC; N2 119-forward TTTTATCTGACCAACACCACCATAGAG; N2 119reverse BIOTIN-CGCTAAGGGGTCCTATCATGTACT; N2 119-sequence ACATCTGGGTGACAAGA; N2 292-294-forward...

4
307
0

Báo cáo y học: "Long Term Persistence of IgE Anti-Influenza Virus Antibodies in Pediatric and Adult Serum Post Vaccination with Influenza Virus Vaccine"

Danh mục: Y học thưởng thức

... study, vaccinated adult (live attenuated vaccine) and pediatric (nasal vaccine) patients (2-20 months post vaccination), with both normal and elevated serum IgE levels, had specific IgG and IgE anti-influenza ... Delfraro A, Borthagaray MD, Velazques B, Garcia-Barreno B, Hortal M Evaluation of immunoglobulin E-specific antibodies and viral antigens in nasopharyngeal secretions of children with respiratory ... immunoglobulin anti-viral responses may differ in vaccinated subjects of African American or Hispanic descent as has been shown in other vaccine trials (34) Additional studies towards understanding immunoglobulin...

6
598
1

Báo cáo y học: "Hepatitis C Virus (HCV) Infection and Hepatic Steatosis"

Danh mục: Y học thưởng thức

... Steatopsis and hepatitis C virus: Mechanisms and significance for hepatic and extrahepatic disease Gastroenterology 2004;126:586-97 22 Zaitoun AM, Al Mardini H, Awad S, et al Quantitative assessment ... G, et al Nonalcoholic fatty liver, steatohepatitis, and the metabolic syndrome Hepatology 2003; 37:917 Sanyal AJ, Campbell-Sargent C, Mirshahi F, et al Nonalcoholic steatohepatitis: Association ... G, Harper F, Harada T, et al Hepatitis C virus core protein shows a cytoplasmic localization and associates to cellular lipied storage droplets Proc Natl Acad Sci U S A 1997;94:1200-5 27 Moradpour...

4
438
0

Báo cáo y học: "Hepatitis B Virus (HBV) and Hepatitis C Virus (HCV) Dual Infection"

Danh mục: Y học thưởng thức

... al The Gambia Liver Cancer Study: Infection with hepatitis B and C and the risk of hepatocellular carcinoma in West Africa Hepatology 2004;39:211-219 54 Saito I, Miyamura T, Ohbayashi A, Harada ... Harada H, Katayama T, Kikuchi S, Watanabe Y, et al Hepatitis C virus infection is associated with the development of hepatocellular carcinoma Proc Natl Acad Sci USA 1990;87:6547-6549 55 Chiba T, ... Chiba T, Matsuzaki Y, Abei M, Shoda J, Tanaka N, Osuga T, Aikawa T The role of hepatitis B virus infection and heavy smoking in hepatitis C virus-related hepatocellular carcinoma Am J Gastroenterol...

6
621
1

Báo cáo y học: "Hepatitis C Virus Serologic and Virologic Tests and Clinical Diagnosis of HCVRelated Liver Disease"

Danh mục: Y học thưởng thức

... RNA 3.0 Assay (Bayer Healthcare) ; and two are based on real-time PCR amplification, Cobas® TaqMan HCV Test, which can be coupled with automated extraction in Cobas Ampliprep® (Roche Molecular ... Technique Lower limit Dynamic of detection range of (qualitative quantification assay) (quantitative assay) HCV RNA quantification HCV RNA can be quantified by means of target amplification techniques ... Med Sci 2006, 36 TMA-based assay Versant® HCV RNA Qualitative Assay (Bayer HealthCare) is 10 IU/ml (Table 1) Real-time PCR assays, which are also able to quantify HCV RNA, have lower limits of...

6
612
0

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Danh mục: Y học thưởng thức

... Okinawa, Japan J Gastroenterol 1994;29:276–281 61 Qadi AA, Tamim H, Ameen G, Bu-Ali A, Al-Arrayed S, Fawaz NA, Almawi WY Hepatitis B and Hepatitis C virus prevalence among dialysis patients in Bahrain ... street outreach and self collected sampling Sex Transm Infect 2005; 81(1):53-8 44 Tanaka J, Kumagai J, Katayama K, Komiya Y, Mizui M, Yamanaka R, Suzuki K, Miyakawa Y, Yoshizawa H Sex- and age-specific ... Tsuda F, Nagayama R, Yamamoto K, Tanaka T, Tokita H, Okamoto H, Miyakawa Y, et al Hepatitis C virus RNA and antibodies among blood donors in Beijing J Hepatol 1994;21: 634–640 23 Zhang YY, Hansson...

6
486
0

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Danh mục: Y học thưởng thức

... infection among African Americans (86%), compared to Caucasians (68%) (p=0.02) In addition, African American had a lower rate of sustained viral response (SVR) to interferon and ribavirin treatment ... among different racial and ethnic groups with HCV infection For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians and Hispanic whites In prospective ... of hepatocellular carcinoma and death Gut, 2000 47(1): 131-6 65 Chiba T, et al Multivariate analysis of risk factors for hepatocellular carcinoma in patients with hepatitis C virus-related liver...

6
530
0

Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Danh mục: Y học thưởng thức

... immunology of viral hepatitis B and C as well as basic and clinical aspects of gastrointestinal malignancies, especially hepatocellular and colorectal carcinoma Darius Moradpour, MD, was Assistant Professor ... HJr., Morgan TR, Balan V, Diago M, et al Peginterferon-alpha 2a and ribavirin combination therapy in chronic hepatitis C: a randomized study of treatment duration and ribavirin dose Ann Intern Med ... virus RNA replication is regulated by host geranylgeranylation and fatty acids Proc Natl Acad Sci U S A 2005; 102: 2561-6 68 You S, Stump DD, Branch AD and Rice CM A cis-acting replication element...

6
497
1