... subunit (Tc00.1047053510993 10), F, 5¢-ACAACGTGCAAAGGCTTCTT-3¢; R, 5¢-CTC GTGCCAACTCCAAGTTT-3¢ PCR, using a Bio-Cycler II thermocycler (Peltier Thermal Cycler; Bio-Rad, Hercules, CA, USA), included ... (Tc00.1047053509891.40), F, 5¢-GCCG TCATGCAAAAATATCC-3¢; R, 5¢-CCTTTTCAGCCAA AAAGCTG-3¢; putative glucose-regulated protein 78 (Tc00.1047053506585.40), F, 5¢-TGGCGGTAAGAAGAA GCAGT-3¢; R, 5¢-CCGAGGTCAAACACAAGGAT-3¢; ... 5¢-TGGGGAGGATTATAGCGATG-3¢; R, 5¢-ACTTC GGCAGAGCACTTCAT-3¢; putative mucin TcMUCII (Tc00.1047053506131.20), F, 5¢-GCGGAGAACAAGATG AGGA-3¢; R, 5¢-TCGCTTTTGAAATAGGCACC-3¢; hypothetical protein (Tc00.1047053509891.40),...
Ngày tải lên: 15/03/2014, 23:20
... time, (b) rice variety OM2717 Figure Effect of tempering time and drying temperature on breaking force (mechanical strength) of rice kernels Colour of milled rice The color of the milled rice was ... oisture content, %wb 40 10 Tempering duration 0 10 20 30 40 50 60 70 Ope ration tim e, m in 8 0C, 2.5 8 0C, 3.0 9 0C, 2.5 9 0C, 3.0 8 0C, 2.5 8 0C, 3.0 9 0C, 2.5 9 0C, 3.0 Figure The reduction of moisture contents ... Texture Analyzer software, the peak force at which rice kernel failure occurred was regarded as breaking force of the rice kernel Colour determination The objective of the color measurement was...
Ngày tải lên: 21/06/2014, 06:20
Designation: C 185 – 01 - Air Content of Hydraulic Cement Mortar1 ppsx
... Sample the cement in accordance with Practice C 183 Procedure 9.1 Batch—Proportion the standard mortar using 350 g cement to 1400 g 20–30 standard sand and sufficient water to give a flow of 871⁄2 ... (1) Air content, volume % 100 2.5W where: W = mass of 400 mL of mortar, g, and P = percentage of mixing water, based on mass of cement used Air content, volume % 100 W NOTE 5—Difficulty has occasionally ... more than 3.5 mm in thickness 5.5 Weights and Weighing Devices, shall conform to Specification C 1005 Evaluate the weighing device for precision and accuracy at a total load of kg 5.6 Glass Graduates—Glass...
Ngày tải lên: 10/07/2014, 23:20
Báo cáo lâm nghiệp: " Growth and mineral content of young chestnut trees under controlled conditions of nutrition" ppsx
... consisted of a single supply of Ca + Mg (2 cmolc of Ca and 0.5 cmolc of Mg per kg of 2+ 2+ soil, corresponding to 2000 kg.ha (42.0% CaO -1 + 10.0% MgO)); C consisted of B conditions + macroelements ... role of calcium in ringshake It will be necessary to study mechanical resistance of wood in correlation with calcium content in order to find out if calcium deficiency in situ influences the mechanical ... capacity of terized by a 1.32 cmolc.kg with exchangeable basic cations: -1 : 2+ Ca 0.30 : 2+ Mg 0.12cmolc.kg ; -1 : + K 0.18 cmolc.kg a total acid cations: H : + -1 and 0.15 cmolc.kg Al 0.40 cmolc.kg...
Ngày tải lên: 08/08/2014, 18:22
Báo cáo khoa học: "gelling agents on growth, mineral composition and naphthoquinone content of in vitro explants of hybrid walnut tree (Juglans regia x Juglans nigra)" pdf
... Approximately 50 mg of dried leaves (at 80 C, over 48 h) were mineralized by the consecutive addition of ml concentrated nitric acid and ml concentrated hyperchloric acid Organic matter was totally ... 1984) and could be used as an indicator of in vitro culture dysfunctioning The aim of this study was to compare the effects of gelling agents, Difco Bacto Agar® (Difco) and Gelrite® (Kelco) ... modified: Na concentration The mineral content of the leaves varied according to the gelling agent and the period of time in culture A significant accumulation of Na was found in the leaves of the...
Ngày tải lên: 08/08/2014, 23:22
báo cáo khoa học: " Effect of filtration on morphine and particle content of injections prepared from slow-release oral morphine tablets" ppt
... produce particles in the extract [17] These include cetostearyl alcohol, which is a mixture of two waxes: cetyl alcohol (1hexadecanol, mp 49 C) and stearyl alcohol (1-octadeca- nol, mp 61 C) ; ... droplets of melted wax The microscopic appearance of hot extractions was characterised by droplets, particles, and crystals (Figure 6A and 6D) The larger droplets had inclusions, either particles ... >4 Particle size Cold Extract: Cig.Filtrate Particles per injection (thousands) 5000 10 1000 Particle size Control Extract: Cig Filtrate Particles per injection (thousands) 2000 10 Particle size...
Ngày tải lên: 11/08/2014, 18:20
Timing and information content of insider trades, before and after the sarbanes oxley act of 2002
... Section 16 of the Securities Exchange Act of 1934, and consisted of filing a Form with the SEC within ten days after the close of the calendar month during which the transaction occurred Section ... and Section 403 of the Sarbanes-Oxley Act subsequently I select all purchases and sales (including those of shares acquired through option exercises) executed by CEOs, CFOs, COOs, Chairmen of the ... officers and principal stockholders with holdings over 10% of a firm ’s stock, all subject to disclosure requirements as defined in Section 16 of the Exchange Act of 1934 until August 2002, and...
Ngày tải lên: 30/09/2015, 17:19
Báo cáo khoa học: Conformational stability and multistate unfolding of poly(A)-specific ribonuclease docx
... Structural features of the intermediates accumulated during the GdnHCl-induced (A C) and ureainduced (D–F) unfolding of PARN by CD (A,D), intrinsic fluorescence (B,E) and ANS fluorescence (C, F) ... denaturant concentration than dissociation A Equilibrium unfolding of PARN by GdnHCl CD and intrinsic and extrinsic fluorescence were used to monitor the secondary and tertiary structural changes of PARN ... intermediate accumulated between 0.5 and m GdnHCl The intrinsic Trp fluorescence and extrinsic ANS fluorescence data indicated that GdnHCl-induced PARN unfolding involved at least two intermediates accumulated...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo toán học: "Exact sequences for K-groups and Ext-groups of certain cross-product C*-algebras " pot
Ngày tải lên: 05/08/2014, 09:46
Báo cáo y học: " Biochemical and virological analysis of the 18-residue C-terminal tail of HIV-1 integrase" pot
... AE3699 (5'TGGTGCTCGAGTGCGGACCCACGCGGGACGAGTGCCATCTCACCGTCCTCTCTTGC) and AflII-tagged AE3700 (AACATCTTAAGACAGCAGTAC) and the resulting digested fragment was ligated with XhoI/AflII-cut pKBIN6Hthr ... (5'-PO4TCGACAGGAGATGGACAGCGGAAGTCACCTGGAGGG Page of 13 (page number not for citation purposes) Retrovirology 2009, 6:94 CGCAAGAGAGGACGGTGAGATGGCATAAG) with AE3698 (5'-PO4GATCCTTATGCCATCTCACCGTCCTCTCTTGCGCCCTC ... (5'-ACAGGATGAGGATTAACTGATGATAAGCTTTAGTAAAACACCATATG)/AE1065 (5'CATATGGTGTTTTACTAAAGCTTATCATCAGTTAATCCTCATCCTGTC) IN deletion mutations were subsequently constructed in pUCWTpol3stop or pKBIN6Hthr by PCR Plasmid...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: " Transactivation and signaling functions of Tat are not correlated: biological and immunological characterization of HIV-1 subtype-C Tat protein" docx
... Research and Reference Reagent Program) and incubated for 72 h Extraction of the total RNA and cDNA preparation were as described above The reverse primer (N529: 5'-CTCCACCCTCGAGATGGACCGGATCTGTCTCTGT-3') ... 94 C, followed by 40 cycles, with each cycle consisting of incubations at 94 C for 30 sec, 60 C for 30 sec, and 72 C for 30 sec The amplified product was purified using a column-based commercial ... primer (N495: 5'GCCCTCTCTCGAGGTCGAAGGGGTCTGTCTC-3') The same primer in combination with a forward primer (N335: 5'-GAGGAGCATATGGAGCCAGTAGATCCTAAC3') was used in the polymerase chain reaction to amplify...
Ngày tải lên: 13/08/2014, 09:20
ASTM Designation: C 596 – 96e1 pot
... conform to the requirements of Test Method C 157 5.7 Length Comparator—The length comparator shall conform to the requirements of Specification C 490 12 Calculation 12.1 Calculate the length change ... conform to the requirements of Specification C 490 6.2 Moist Storage Facility—The temperature and humidity of the air in the moist storage facility shall conform to the requirements of Specification ... Specification C 511 6.3 Drying Room and Controls—The drying room and controls shall conform to the requirements of Test Method C 157 Graded Standard Sand 7.1 The graded standard sand shall conform to Specification...
Ngày tải lên: 10/07/2014, 23:20
ASTM Designation: C 706 – 98 - Limestone for Animal Feed Use1 pps
... revision of this standard or for additional standards and should be addressed to ASTM Headquarters Your comments will receive careful consideration at a meeting of the responsible technical committee, ... C 706 The American Society for Testing and Materials takes no position respecting the validity of any patent rights asserted in connection with any item mentioned in this standard Users of ... this standard are expressly advised that determination of the validity of any such patent rights, and the risk of infringement of such rights, are entirely their own responsibility This standard...
Ngày tải lên: 10/07/2014, 23:20
guide for use of normal weight and heavyweight aggregates in concrete
... elasticity Specific heat Conductivity Diffusivity None CRD -C- 124 None None Specific gravity ASTM C 127 ASTM C 128 ASTM C 295 ASTM D 4791 CRD -C- 120 ASTM C 1252 ASTM D 3398 ASTM C 136 CRD -C- 104 Particle ... Ultimate Strain Capacity of Concrete CRD -C- 104 Calculation of the Fineness Modulus of Aggregate CRD -C- 114 Soundness of Aggregates by Freezing and Thawing of Concrete Specimens CRD -C- 120 Flat and Elongated ... Lightweight Pieces in Aggregate Terminology Relating to Concrete and Concrete Aggregates NORMAL WEIGHT AND HEAVYWEIGHT AGGREGATES C 127 C 128 C 131 C 136 C 142 C 227 C 289 C 295 C 418 C 441 C 535...
Ngày tải lên: 24/10/2014, 15:48
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... questionnaire was used to collect information on participant characteristics such as age, level of education, family income, occupation, smoking, alcohol consumption and history of hypertension, coronary ... disease (CHD), stroke, and cancer Anthropometric measurements, including weight, height, and circumferences of the waist and hips, were taken at baseline recruitment according to a standard protocol ... previous years and provided information on daily activity such as walking, stair climbing, cycling, household activities and daily commuting to and from work (walking and cycling) We calculated the...
Ngày tải lên: 31/10/2012, 16:49
Tài liệu Effect of KNO3 Spraying on yield and yield Component of rice on degraded Soie in Bac GiangSummer rice – 2009 docx
... Effect of KNO3 Spraying on yield and yield Component of rice on Alluvial Soie in Nam Dinh- Spring Rice – 2009 ( Quinal/ha) Number of paricals/m2 Number of grain/pan 1A 1B 12 LS DO5 % of umfiiied ... grain 1000 grain weight( g) Grain yield Tab 5: Effect of KNO3 Spraying on yield and yield Component of rice on Alluvial Soie in Nam Dinh- Summer rice – 2009 ( Quinal/ha) Number of paricals/m2 1A 1B ... Number of grain/pan % of umfiiied grain 1000 grain weight( g) Grain yield Tab 6: Effect of KNO3 Spraying on rice yield on degraded Soie in Bac Giang 2009 ( Quinal/ha) Treat Spring Rice Summer Rice Yield...
Ngày tải lên: 20/01/2014, 02:20
Tài liệu The Dynamic Retention Model for Air Force Officers- New Estimates and Policy Simulations of the Aviator Continuation Pay Program doc
... development of personnel policies RAND Project AIR FORCE RAND Project AIR FORCE (PAF), a division of the RAND Corporation, is the U.S Air Force’s federally funded research and development center for ... distribution of Academy graduates and non-Academy officer accessions differ from those of Gotz and McCall Specifically, Gotz and McCall found Academy graduates to have lower taste for the military than nonAcademy ... predicted versus cumulative retention rates for ROTC accessions The DRM included indicator values for the mode and scale of the taste distribution for ROTC accessions; the Air Force Academy and...
Ngày tải lên: 17/02/2014, 23:20
Air Pollution and the Health of New Yorkers: The Impact of Fine Particles and Ozone pot
... particles in New York City’s air come from sources both within and outside of the city; the outside sources account for more of the city’s air pollution, but local sources account for differences ... combustion for generating electric power and heating residential and commercial buildings; off-road vehicles (such as construction equipment); and commercial cooking (U.S Environmental Protection ... Department of Health and Mental Hygiene Table of Contents Executive Summary Introduction and Background Sources and Health Effects of Fine Particulates and Ozone Studies of Air Pollution...
Ngày tải lên: 06/03/2014, 16:20
Direct HFC and PFC Emissions from Use of Refrigeration and Air Conditioning Equipment pptx
... type, and the charge capacity of each piece of equipment where: CD = charge capacity of the piece of equip ment being disposed of y = percent of the capacity remaining at disposal z = percent of ... (ODSs), primarily chlorofluorocarbons (CFCs) and hydrochlorofluorocarbons (HCFCs) However, in accordance with the Clean Air Act Amendments of 1990 (Title VI) and the Montreal Protocol, these ODSs ... at Disposal y Recovery Efficiency z (% of capacity) (% of capacity/yr.) (% of capacity) (% of remaining) Domestic Refrigeration 0.05–0.5 0.5 80 70 Stand-alone Commercial Applications 0.2–6 15...
Ngày tải lên: 08/03/2014, 19:20
The Gravity of Weight A CLINICAL GUIDE TO Weight Loss and Maintenance pdf
... Silverman Professor of Psychiatry and University Chairman, Department of Psychiatry and Behavioral Sciences, Albert Einstein College of Medicine, and Psychiatrist-in-Chief, Montefiore Medical Center, ... appreciate just how unpredictable and even seemingly capricious—the consequences of obesity can be and how much we still not know about the complex subject of weight Statistics can never account ... medical community As medical research and practice continue to advance, however, therapeutic standards may change Moreover, speci c situations may require a speci c therapeutic response not included...
Ngày tải lên: 15/03/2014, 04:20