weight is not just a female issue

... possible is preferred distance in sentences and markables part of speech of the head of the markables the grammatical functions parallelism of grammatical functions the heads match or not where is ... succeeding markable? This is linguistically implausible Pronouns are acting as a kind of local variables A ’he’ at the beginning of a text and a second distant ’he’ at the end of the text hardly tend ... it is related to another markable that is already member of the set) it is verified that it is compatible with all members of the set A markable i is compatible with a coreference set if, for all...

Ngày tải lên: 31/03/2014, 20:20

... draws is the chance to start a business that can turn a hobby into a pastime, an avocation into a vocation Robin Knepp spent nine years in the Marine Corps, rising to the rank of captain as a ... Working as a consultant for a large technology consulting company often meant he was in an airplane five nights a week, away from family, away from his home, and away from his life "There was something ... income adequate to provide significant financial assistance to a college student, which he was at the time If Jeremy can make a business from a fantasy role-playing card game, it's hard to say what...

Ngày tải lên: 01/06/2014, 10:25

... non-senescent leaves have already been degraded Given that the current database of Arabidopsis ESTs does not represent senescing tissues, it is perhaps not surprising that an additional 100 new genes, not ... leaf is induced by an array of endogenous factors, such as age and hormonal regulation, as well as by external factors, such as biotic and abiotic stresses It is not known how these signals are ... sequence annotation and classification of genes in the Arabidopsis databases The general picture emerging from this study is that leaf senescence is indeed, like any other developmental process, a very...

Ngày tải lên: 09/08/2014, 20:20

... CVVHD and sepsis-related disseminated intravascular coagulation Two days later, right hand cyanosis was noted and attributed to the presence of a right radial arterial catheter, which was removed ... prior heparin exposure and a low or falling platelet count In addition, effective treatment is available with the anticoagulants argatroban and lepirudin Lastly, a readily available test with a high ... died after cardiac arrest No autopsy was obtained Discussion Thrombocytopenia, a commonly encountered condition in hospitalized patients, is often nothing more than a statistical laboratory variant...

Ngày tải lên: 11/08/2014, 10:22

... patients and carried a higher mortality [13] Nevertheless, the standardized mortality ratio was similar in patients who had AF and in patients who did not have AF, suggesting AF is rather a marker ... K, Lekakis J, McGregor K, Metra M, Morais J, Osterspey A, Zamorano JL, Smith SC Jr, Jacobs AK, Adams CD, Anderson JL, Antman EM, Hunt SA, Nishimura R, Ornato JP, Page RL, Riegel B: ACC/AHA/ESC ... P, Mazer CD, Barash PG, Hsu PH, Mangano DT: A multicenter risk index for atrial fibrillation after cardiac surgery JAMA 2004, 291:1720-1729 Artucio H, Pereira M: Cardiac arrhythmias in critically...

Ngày tải lên: 13/08/2014, 21:20

... MPI Ministry of Planning and Investment MUTRAP Multilateral Trade Assistance Project NAPPA National Academy of Politics and Public Administration NGO Non-governmental Organisation ODA Official Development ... what the law is intended to achieve Policymaking and legal drafting have subsequently not been separated and specialised, which has meant the arguments for drafting particular laws are not always ... international treaties such as Asia-Pacific Economic Cooperation, the ASEAN Free Trade Area and the World Trade Organization (WTO), Vietnam agreed to harmonise its commercial laws with international...

Ngày tải lên: 08/08/2015, 19:23

... only a representative sampling from a larger number of such registrations revealed by his search Ser No 75/934,127 Applicant filed a Notice of Appeal with the Trademark Trial and Appeal Board, along ... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... next article mentions that particular vitamins are ingredients in a skin cream for use with skin that has been damaged by wind, sun or shaving Another excerpt notes that a particular company sells...

Ngày tải lên: 20/12/2013, 23:15

... A. -R Karala and L W Ruddock bacitracin contains at least nine different peptides, of which bacitracin A is the most abundant, and it is mainly used as an antibiotic against infections caused ... thiol–disulfide exchange enzymes, Escherichia coli DsbA and DsbC, as well as the isolated catalytic a domain of PDI Both the PDI a domain and DsbA have a catalytic site, with an associated substrate-binding ... propose that bacitracin should not be regarded as a specific inhibitor of PDI Results Bacitracin does not inhibit the catalysis of disulfide bond formation and isomerization by PDI PDI is a catalyst...

Ngày tải lên: 16/02/2014, 14:20

... stated) and legal disclaimers All of this peripheral information serves as a constant reminder that a game is being played Another barrier to player immersion in the Nokia Game is its reliance on ... with visitor traffic and inquiries, and its owner was forced MelbourneDAC 2003 to replace his home page with a "This is not a game" disclaimer [5] As you can imagine, an audience that is quite ... unfolding of the answers IS the narrative that has me hooked… a meta-narrative" [20] In another editorial "Meta Mystery," Maria Bonasia, a twentysomething Massachusetts-based playwright, discussed "the...

Ngày tải lên: 07/03/2014, 17:20

... F(aa¯ a, aaaa) a ¯ ¯ A( a, a) F (a , aa) a ¯ A( a, a) D (a , aa) a ¯ E (a a, aaa) a ¯ ¯ D (a , aa) a ¯ C(ε, #) A (¯ , a) a ¯ D(ε, ε) F (a , aa) a ¯ A( a, a) D(ε, ε) E(¯ , a) a ¯ D(ε, ε) A (¯ , a) ... A, A , C, D, E, F}, Σ = {a, a, #}, and P consists of the following rules: S(x1 y1 , y2 x2 ) ← D(x1 , x2 ), C(y1 , y2 ) C(ε, #) ← S(aa¯ aa¯ , #¯ a aaa) a a a a D(aa¯ aa¯ , aa¯ aaa) a a ¯ a ... here a rigorous, mathematical proof of this fact not relying on the computer verification Head Grammars A head grammar is a quadruple G = (N, Σ, P, S), where N is a finite set of nonterminals, Σ is...

Ngày tải lên: 16/03/2014, 19:20

... this.Outline I) Introduction A) The average definition for a hero B) What Odysseus is like compared to the definition C) Odysseus isn¹t a hero II) Odysseus is self centered A) He doesn¹t take ... members killed at Cyclops¹ because he was being greedy.III) Odysseus is cold-hearted A) He kills people without giving them a chance 1) Suitors 2) Disloyal maids B) He doesn¹t care about people ... prevent deaths of crew membersIV) Odysseus is disloyal A) He had affairs with other women 1) Calypso 2) Circe B) Wife didn¹t betray him 1) with suitors 2) even though he was thought to be dead V)...

Ngày tải lên: 21/03/2014, 22:48

... for all separable unital C ∗ -algebras A Anderson [An] provided in 1978 the first example of a unital C ∗ -algebra A for which Ext (A) is not a group The C ∗ -algebra A in [An] is generated by the ... example of a C ∗ -algebra A for which Ext (A) is not a group Introduction A random matrix X is a matrix whose entries are real or complex random variables on a probability space (Ω, F, P ) As in [T], ... probability theory (cf [V2], [VDN]): a) A C ∗ -probability space is a pair (B, τ ) consisting of a unital C ∗ -algebra B and a state τ on B b) A family of elements (ai )i∈I in a C ∗ -probability...

Ngày tải lên: 22/03/2014, 20:20

... codons for panD and aq477, they appear to be organized as an operon panD encodes an aspartate decarboxylase which catalyses the decarboxilation of aspartate to produce b-alanine, a precursor ... verify that Cys69 is required for ST activity All the activity disappeared at a : molar ratio (iodoacetamide Aq-477) This demonstrates that Cys69 is: (a) involved in the catalysis, and (b) not involved ... catalytic domain of thiosulfate cyanide sulfurtransferase (TST) which is distributed among bacteria, archaea and eukaryotes Aq-477 catalyses sulfur transfer from thiosulfate, tetrathionate and...

Ngày tải lên: 30/03/2014, 03:20

... plate reader Statistical analysis Data were analyzed using prism for Windows (GraphPad Software, Inc., San Diego, CA) Two-way ANOVA was used for assessment of dose–response experiments (Figs and ... suggest increases in cytosolic [Ca2+] in response to CsA and its analogs Both the intracellular Ca2+ chelator BAPTA and the extracellular Ca2+ chelator EGTA caused significant attenuation of the ... derivative NIM811 Mol Pharmacol 62, 22–29 Diaz G, Diana A, Falchi AM, Gremo F, Pani A, Batetta B, Dessi S & Isola R (2001) Intra- and intercellular distribution of mitochondrial probes and changes...

Ngày tải lên: 30/03/2014, 08:20

Ngày tải lên: 05/08/2014, 15:20

... the age of 40 [26] We were unable to evaluate the histological characteristics of primary tumors because this information was not available for all cases Also, we did not analyze the relationship ... Q-L, Abel P, Foster C, Lalani E-N: bcl-2: role in epithelial differentiation and oncogenesis Hum Pathol 1996, 27:102-110 Takaoka A, Adachi M, Okuda H, Sato S, Yawata A, Hinoda Y, Takayama S, ... participated in study design, was in charge of data collection and analysis and helped to draft the manuscript, OCC conceived of the study, and participated in its design and data analysis and...

Ngày tải lên: 09/08/2014, 07:21

... 14 Kawashima M, Kagami Y, Toita T, Uno T, Sugiyama M, Tamura Y, Hirota S, Fuwa N, Hashimoto M, Yoshida H, Shikama N, Kataoka M, Akuta K, Sasaki K, Tamamoto T, Nemoto K, Ito H, Kato H, Yamada S, ... Pignon JP, MetaAnalysis of Radiotherapy in Carcinomas of Head and neck (MARCH) Collaborative Group: Hyperfractionated or accelerated radiotherapy in head and neck cancer: a meta-analysis Lancet 2006, ... 465 Kajiicho Kawaramachi Hirokoji, Kamigyo-ku, Kyoto 602-8566 Japan Department of Radiology, National Hospital Organization, Osaka National Hospital, Hoenzaka 2-1-14 Chuo-ku, Osaka city, Osaka 540-0006...

Ngày tải lên: 09/08/2014, 09:20

... Hsp90 is impaired, hidden genetic variation is revealed, resulting in altered genetic signal inputs (black peaks) that are abnormally outputted These altered outputs may lead to an abnormal phenotypic ... This pathway is called the primary processing path­ way [5,6] The mechanism of their production, however, has been largely unclear During spermatogenesis in Drosophila males, antisense piRNAs ... phenotypic variation Transposition is also potentially adaptive by occasionally providing a source of genetic diversity [8] Thus, a trans­ posable element is often defined as a natural, endogenous,...

Ngày tải lên: 09/08/2014, 20:21

... Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there is ... to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed by restriction endonuclease digestion and religation ... numerical values Intact mRNA was successfully extracted from as little as 400 µl of whole blood, comparable amounts to that obtained from infants via heelstick This mRNA was used to quantify the amount...

Ngày tải lên: 11/08/2014, 08:20