... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu domain...
... be comes fixed cells of plants animal and hum en After the death ofthe organism the exchange with the evironment stops Because ofthe decay of Nc , the specific activity of 1'( decreases according ... e as inthe atmosphere Therefore, the specific activity of atm ospheric carbon can be calculated using the specific activity in plants in equilibrium with the environment The survey in 2006 from ... Fig Comparative measurement of "C specific activity) Bq/kgC) vs time [2,3] C o n clu sio n s (i) In Table 1, the measured , 4C specific activity showed that: The "C specific activity (Bq/kgC) in...
... This involves conversion of UDP-glucuronate to UMP inthe lumen ofthe vesicles and exchange ofthe latter with cytosolic UDPGlcNAc Once inside microsomes, the latter can, in turn, be exchanged ... formation of glucuronate Interestingly, vitaminC formation is induced in Gunn rats by phenobarbital [8], an inducer of UGT2s, which is indirect evidence for the involvement of members ofthe UGT2 ... except that, because ofthe presence of saccharo1,4-lactone, an inhibitor of b-glucuronidase, inthe samples where b-glucuronides had to be determined, the amount of b-glucuronidase and the incubation...
... of error According to Richard (1992: 95), error is the use of a linguistic item inthe speech or writing of a second or foreign language learner, such as a grammatical item, a speech actect in ... errors that they usually make in their writing Since the students were conscious ofthe importance of doing well inthe tests, they tried their best to finish them However, the limitation of time ... Factors affecting second language learning There have been many books discussing about factors which affect second language learning And basing on the collection from these books ideas, we can...
... endpoint a What is the concentration ofvitaminCinthe juice in mg vitamin C/ 100 mL of juice (mg/ 100 mL)? b What quantity of juice will provide the RDA amount ofvitaminC (mL)? Experiment 3 ... 3‐5 C- 2 Unknown Sample Mass or volume of unknown Initial buret reading (mL) Final buret reading (mL) Moles of iodine added Moles ofvitaminCin sample Mass ofvitaminCin sample (mg) Percent vitamin ... iodine solution Note the change ofthe I2 color as you swirl the flask gently and continuously during the titration Continue the addition ofthe iodine, using progressively smaller volume increments,...
... courts were the Court of King’s Bench (Bancus Regis, B.R.), the Court ofCommon Pleas (Common Bench, C. B.), and the Court of Exchequer Four judges sat on each of these three courts, and together ... appears, that the said Book has been constructed according to the discretion or caprice ofthe acting Secondary for the time being, who had theretofore claimed and exercised the right of placing upon ... (See also the description ofthe special jury selection inthe case of Rex v Nutt, MMSS II: 782–84.) Minutes ofthe Proceedings ofthe Court ofCommon Council (London, 1817), 152, 209, CRO Ibid.,...
... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast strains ... the end ofthe C- terminal helix) with the distinct SRH inthe meiotic clade of AAA ATPases Since the conserved FG motif at the end ofthe C- terminal helix lies in close proximity to the SRH in ... RIX7) is included for interest The secondary structure ofthe C- terminal sequences of these proteins as predicted using Phyre is also shown [58] (H, helix; C, coil) S .c. , Saccharomyces cerevisiae...
... ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT A-3¢ The PCR product was cloned into the pDONR201 vector, and the resulting plasmid, ... Isolation of a cDNA coding for l-galactono -c- lactone dehydrogenase, an enzyme involved inthe biosynthesis of ascorbic acid in plants Purification, characterization, cDNA cloning, and expression in yeast ... of M tuberculosis Despite the presence of l-gulono-1,4-lactone dehydrogenase activity inthe M bovis BCG Copenhagen strain, ascorbic acid could not be detected inthe M bovis BCG and M tuberculosis...
... addition of scintillation fluid Nonspeci c binding was determined inthe presence of lm unlabeled agonist and subtracted from the total binding to calculate the speci c binding Internalization of [3H]BK ... comprising putative helix 8, may be involved inthe interaction of GPCRs with cognate G proteins Synthetic peptides from the C- terminus ofthe Ga subunit Gt and ofthe Gc subunit of transducin interacted ... that activation ofthe receptor, and subsequently ofthe G protein, leads to a change inthe environment of helix resulting inthe loss ofthe helical structure Mutation of speci c residues in their...
... processing is distinct from that ofthe ascomycete laccases, because the C- terminus ofC cinereus laccase does not contain the conserved ascomycete cleavage site [24] The role of C- terminal processing ... mutant, the forward primer 5¢-CGAATCCCTACCCCAAGATCTGAT CGGGCCTGAAGCGTCGCCG-3¢ and the reverse primer 5¢-CGGCGACGCTTCAGGCCCGATCAGATCTTGGGG TAGGGATTCG-3¢ were used Briefly, the mutagenesis was achieved ... 5¢-ACCCCAAGATCGACTGGGCGG TAAG CGTCGCGCTGGGTGGAGGA-3¢ and 5¢-TCCTCCACC CAGCGGCGACGCTTACCGCCCGAGTCGATCTTGG GGT-3¢ were used as forward and reverse primers, respectively For construction ofthe Tr(delDSGL559)...
... by bovine heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 ofthe coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) ... alanines Oligonucleotides cassettes containing the desired mutations were inserted into pcDNA3-HIP/PAPmyc-His as indicated by the manufacturer Direct sequencing confirmed the sequence ofthe inserts ... group of C- type lectins because it binds lactose and contains only one CRD [3,4] The HIP/PAP sequence (the 146 C- terminal amino acids) present inthe probe used to screen the cDNA library encompasses...
... treatment phase assessing the Total Clinical Score (TCS) The Total Clinical Score is defined as the sum of erythema (0-3), scaling (0-3) and thickness (0-3) scores Total Clinical Scores therefore range ... obtaining early clinical "proof -of- concept" for comparing several treatments and for exploring the mechanism of action of topical anti-psoriatic treatments inthe relevant patient setting Conclusion ... larger clinical studies [4-6] The time course ofthe clinical effects also matched those seen in other clinical studies, with a fast onset by Daivobet® already showing significant clinical effect...
... “Comparative performance of different skin chrominance models and chrominance spaces for the automatic detection of human faces in color images,” in Proceedings ofthe 4th IEEE International Conference ... constraints to improve the training of classifiers (1) The labeled pairs may or may not correspond to the same subject The accuracy of this labeling process is crucial for a further training task ... the silhouette image in every half second from the tracking sequence, we constructed a dataset including 102 tracking sequences and 778 sampling images from 10 human subjects We adopt the accuracy...
... as the surface structure of a language It is the structural part of language which is actually seen in print or heard in speech In translation the form ofthe source language is replaced by the ... message as the source language but using the natural grammatical and lexical choices ofthe receptor language The basic overriding principle is that an idiomatic translation reproduces the meaning ... modernization - Vẫn chưa cc ch chữa trị bệnh AIDS = There has been no cure for AIDS 1.5 The factors influencing translation process 1.5.1 Influence ofthe mother tongue Inthe process of learning a foreign...
... D is the total weight of T Inthe course ofthe proof, we assume T is binary, which follows from the construction of Bocci and Cools [2] Notice they start with a phylogenetic tree and then define ... ultrametric associated with its 2-dissimilarity vector, therefore inducing an ultrametric tree Here, T corresponds to certain subtrees of this induced ultrametric tree the electronic journal of combinatorics ... gives a point inthe tropical Grassmannian Gm,n , and therefore gives rise to a tropical linear space The combinatorial structure of those tropical linear spaces is the subject of an upcoming paper...
... as B cells, T cells, granulocytes and macrophages helped inthe characterization of these cells We detected B cells in some secondary lymphoid follicles and a few scattered inthe tissue T cells ... HL-60 cells, a myelomonocytic cell line [5] The following primers were used in this study: PR-3 ‘sense’, 5′-ATCGTGGGCGGGCACGAGGCG (at the beginning of exon 2, corresponding to bases +82 to +101 of ... with light and fluorescent microscopy The lectin of B purpurea binds specifically to pneumocytes type I, whereas the lectin of M pomifera binds to pneumocytes type II Microscopic evaluation and semiquantitative...
... affecting joint laxity and the other affecting the shape of acetabulum to be responsible for the causation of DDH Carter and Wilkinson reported increased incidence of joint laxity with DDH in ... the mode of transmission of this condition Competing interests We hereby categorically declare that none ofthe authors have any financial or non-financial competing interests inthe publishing ... publishing of this manuscript Authors' contributions BK and CD performed the molecular assays CD and CHWJ were involved inthe conceptualisation ofthe study as well as defining the radiographic measurement...