... represents the A ϭ 1Ϫ [ (A / (A A )) (A Ј/ (A Ј A Ј)) ( (A / (A A )) (A / (A A )) ϩ (A Ј/ (A Ј A Ј)) (A Ј/ (A Ј A Ј)) ) ] Statistical analysis1 The data for the analysis were arranged by pairing of the ... same individuals using our novel quantitative transcriptional clonality assay Formal statistical analysis, using an exact binomial test, further emphasized the discrepancy between results obtained ... results obtained using our novel transcriptional clonality assay and analysis of methylation at the HUMARA locus (P Ͻ 001; exact 95% CI, 0-0.1) Validation of quantitative clonality assay in patients...
Ngày tải lên: 05/03/2014, 21:20
... or not an alternative repayment arrangement is necessary and, if so, what type(s) of alternative repayment arrangement(s) appropriate to your circumstances can be made available If an alternative ... sites, media and printed material We have specially-trained personnel in our offices and branches, including specialised telephone contact points, to deal with customers facing or in financial difficulties ... that the information is accurate, enabling us to work with you to determine the most appropriate and viable option in each particular customer case The easiest way to see where you stand financially...
Ngày tải lên: 29/03/2014, 18:20
Báo cáo Y học: The cytoplasmic C-terminus of the sulfonylurea receptor is important for KATP channel function but is not key for complex assembly or trafficking pdf
... as indicated Statistical analysis was carried out using one-way ANOVA with an appropriate posthoc test or Students t-test as appropriate (ORIGIN v6.0 and PRISM v3.0) Statistical significance is ... hyperinsulinaemic hypoglycaemia of infancy The disease is autosomal recessive and is characterized by profound neonatal hypoglycaemia and Fig Analysis of channel subunit trafficking using surface ... Matsushita, K., Katayama, Y., Fujita, A. , Inageda, K., Tanemoto, M., Inanobe, A. , Yamashita, S., Matsuzawa, Y & Kurachi, Y (2000) C-terminal tails of sulfonylurea receptors control ADP-induced activation...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo hóa học: " Dissecting the role of putative CD81 binding regions of E2 in mediating HCV entry: Putative CD81 binding region 1 is not involved in CD81 binding" pot
... Y61 8A H61 7A W61 6A L61 5A R61 4A Y61 3A F55 0A W54 9A D53 5A D53 3A W52 9A Y52 7A R49 2A Y48 9A H48 8A W48 7A Y48 5A R48 3A D48 1A Y47 4A EnvA VSVG HCV WT A ~70kDa E2 actin Y61 8A H61 7A W61 6A L61 5A R61 4A F55 0A Y61 3A ... W61 6A all displayed a disrupted AR 3A epitope in this region, indicative of more global structural aberrances Y52 7A, W52 9A, Y61 3A, H61 7A and Y61 8A have intact conformation and still are unable ... Vitelli A, Meola A, Scarselli E, Acali S, Pezzanera M, Ercole BB, McKeating J, Yagnik A, Lahm A, Tramontano A, Cortese R, Nicosia A: Binding of the hepatitis C virus E2 glycoprotein to CD81 is strain...
Ngày tải lên: 20/06/2014, 01:20
Chapter 33: Advanced Object-Oriented Concepts s sThe object table itself is not mentioned in the pps
... private variables Examples of Java variable declarations include: char aCharVariable = 'J'; boolean aBooleanVariable = false; By convention, Java variables always start with a lowercase letter, as ... shown in this example In the example, the datatypes are CHAR and BOOLEAN, and each variable is assigned an initial value Note that the assignment character in Java is =, as opposed to := or => in ... V: Java in Oracle In the following listing, the Character.isUpperCase method is used to evaluate the aCharVariable declared earlier: if (Character.isUpperCase(aCharVariable)) { some commands...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo y học: "Differentiation of naive CD4+ T cells towards T helper 2 cells is not impaired in rheumatoid arthritis patients" pps
... permeabilization kit, according to the manufacturer’s instructions (Caltag Laboratories, Burlingame, CA, USA) Fluorochrome-labeled anti-IFN-γ, anti-IL-4 and isotype control antibodies (Caltag Laboratories) ... were added during the permeabilization step (1 µg/ml) to stain the intracellular cytokines Fluorescence was analyzed with a FACScan (Becton Dickinson, Mountain View, CA, USA) The quadrant markers ... blockade in patients with rheumatoid arthritis: a pilot, dose-finding, double-blind, placebo-controlled clinical trial evaluating CTLA-4Ig and LEA29Y eighty-five days after the first infusion Arthritis...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa hoc:" Aortic distensibility measured by pulse-wave velocity is not modified in patients with Chagas'''' disease" pot
... = 0.57) We also did ANOVA analysis by adjusting PWV values by age and mean blood pres- Table 1: Baseline characteristics in control and Chagas' disease groups Variables Age (years) Male sex Systolic ... be an impairment in arterial distensibility Data obtained in experimental studies support this issue by demonstrating that acute infection by trypanosoma cruzi causes inflammatory lesions in large ... consumption) and slope Ve/ Vco2 values during a maximal treadmill test in 50 patients with Chagas' disease Pulmonary ventilation and gasexchange data were determined on a breath-by-breath basis with a computerized...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt
... Tcells analyzed in parallel, while the latter typically showed a faster kinetic (Fig 8A and data not shown) Parallel sampling of culture supernatants and p24 quantification, however, revealed a key ... not translate into an enhanced viral gene expression in this primary cell type, and already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability ... Statistics Unpaired Student's t-test analysis was calculated with the software MS Excel 2003 For the data presented in Fig 10B a linear model variance analysis (repeated measurement design) was...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: " HIV-1 Rev oligomerization is not obligatory in the presence of an extra basic domain" doc
... rev coding region from pcrevM4 was amplified using the primer pairs tcgaagctagtcgacatctcctatg / cggggtaccgcctccttctttagctcc (PCR A) and cggggtaccggaatggcaggaagaagc / ctccagttggtagagagagcag (PCR ... localization was predominantly nuclear and nucleolar while the M4 mutant localized mainly to the cytoplasm with a weak nucleolar and nucleoplasmic staining (Figure 2, panels a and b) The addition ... that the basic domain participates in events other than binding to nuclear import factors and target RNA This implies that at least one of the functional benefits of oligomer formation of Rev is...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "RNA interference is not involved in natural antisense mediated regulation of gene expression in mammals" docx
... glyceraldehyde 3-phosphate dehydrogenase) were calculated as ∆∆Ct Additional data files The following additional data are available with the online version of this paper Additional data file is a ... of antisense transcription in the human genome Nat Biotechnol 2003, 21:379-386 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, Suzuki M, Kawai J, et al.: Antisense ... meta-analysis of NAT expression and suggested that RNA degradation by dsRNA formation is not a predominant route of gene regulation in Arabidopsis thaliana Additionally, endogenous siRNA has been defined...
Ngày tải lên: 14/08/2014, 16:21
Playing With the Boys - Why Separate is Not Equal in Sports
... made much ado about New England Patriots quarterback Tom Brady appearing in Mrs Laura Bush’s box A few noted the attendance of WNBA player Tamika Catchings Sports and Masculinity Athletics are ... Gary King for appointing her as a Visiting Scholar at the Institute for Quantitative Social Science (IQSS) at Harvard University, an invaluable community of scholars We also thank research assistants ... the table of a male breadwinner It reminded all that athletics is more than play Stakes are high because organized sports offer men a means for demonstrating masculinity and displaying physical...
Ngày tải lên: 10/06/2015, 17:16
– GED LITERATURE AND THE ARTS, READING PRACTICE QUESTIONS – 61. d. It is ironic that in a place pdf
... GED has an increased focus on “math in everyday life.” This is emphasized by allowing the use of a calculator on Part I as well as by an increased emphasis on data analysis and statistics As a result, ... regular polygon has sides and angles that are all equal An equiangular polygon has angles that are all equal Angles of a Quadrilateral A quadrilateral is a four-sided polygon Since a quadrilateral ... is a parallelogram that has four equal sides D ■ In a square, diagonals have the same length and intersect at 90-degree angles D C C AB = BC = CD = DA A ■ AC = DB and AC DB B A square is a parallelogram...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx
... centrifugation at 14,000 rpm for 15 minutes to separate into an aqueous RNA phase, an organic protein layer and a DNA interphase RNA was extracted by adding 0.5 ml isopropanol to the aqueous phase and ... Flanagan KL, Aveika AA, Zaman A, RowlandJones S, McConkey SJ, Whittle HC, Marchant A: Risk factors for and clinical outcome of congenital cytomegalovirus infection in a peri-urban WestAfrican ... OA, Mendy M, Akano AO, Sam O, Goedert JJ, Hainaut P, Hall AJ, Whittle H, Montesano R: The Gambia Liver Cancer Study: Infection with hepatitis B and C and the risk of hepatocellular carcinoma in...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo khoa hoc:" Perigraft air is not always pathological: a case report" docx
... graft infection such as malaise or back pain, and he did not experience any gastrointestinal tract bleeding Furthermore, inflammatory markers including full blood count, C-reactive protein and ... negative, and inflammatory markers remained within normal limits As the patient was now apyrexial and continued to be asymptomatic, the decision was made to discharge the patient A repeat CT scan performed ... radiograph was unremarkable On the eighth post-operative day the patient complained of pain and loss of feeling in his left leg On examination his foot was cool, and pedal pulses were impalpable A...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo y học: "Medical emergency motorcycle – is it useful in a Scandinavian Emergency Medical Service?" docx
... two health care professionals is important in conditions like cardiac arrest That fact is not, however, an argument against MEM since in such instances a MEM paramedic can assist the paramedics ... the car ambulance, or vice versa In this study the MEM assisted car ambulances in 17 instances of cardiac arrest and the MEM paramedic also assisted the car ambulance paramedics in other cases ... interventions in 121 patients before the arrival of another ambulance Intravenous drugs were given in 63 cases, including 23 cases of naloxone administration to heroine intoxicated patients Airway management...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " The carbohydrate at asparagine 386 on HIV-1 gp120 is not essential for protein folding and function but is involved in immune evasion" potx
... Colors are the same as in fig 4A Residues important for b12 binding [23] are indicated in blue and the asparagines which anchor the glycans involved in 2G12 binding [10-12] are indicated in magenta ... Conclusion Although the 386 carbohydrate may play a role in Env folding, this is not a crucial one, underlined by the fact that it is not absolutely conserved among primary isolates (15% variability in ... did in part reach the native state R 1a and R1b displayed a faint native band after hrs of chase An unusual property of Env is that it must undergo some initial oxidative folding before its signal...
Ngày tải lên: 13/08/2014, 06:20
Báo cáo y học: " Minimal acupuncture is not a valid placebo control in randomised controlled trials of acupuncture: a physiologist''''s perspective" pps
... kinase-mediated signal pathways, and downstream processes [36] Self- appraisal The brain modulates processes involved in self-appraisal during acupuncture For example, when a patient sees an acupuncturist, ... F, Takahashi T, Moriya J, Kawaura K, Yamakawa J, Kusaka K, Itoh T, Morimoto S, Yamaguchi N, Kanda T: Traditional Chinese medicine and Kampo: a review from the distant past for the future J Int ... Cummings From the studies of the efficacy of acupuncture in migraine, low back pain and knee osteoarthritis pain [5566], an intriguing finding was the strong and lasting response to minimal acupuncture...
Ngày tải lên: 13/08/2014, 15:21
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
Ngày tải lên: 17/04/2013, 16:09
Tài liệu VB .NET Language in a Nutshell pdf
... the Internet marked another change in programming paradigms Yet, Visual Basic's real strength remained as it always had been: a great platform for developing standalone Windows applications This ... Visual Basic 1.0 offered a graphical interface that was suitable for Windows applications, VB NET and Visual Studio NET aim at providing a graphical interface that is suitable for developing web applications ... Why VB NET? 1.2 What Is VB NET? 1.3 What Can You Do with VB NET? Variables and Data Types 2.1 Variables 2.2 Declaring Variables and Constants 2.3 Data Types 2.4 Arrays 2.5 Object Variables and...
Ngày tải lên: 09/12/2013, 17:15
Tài liệu Hướng dẫn lập trình VB.NET Chương 18: Làm việc với máy in pdf
... PageSettings() Private StringToPrint As String Private PrintFont As New Font("Arial", 10) Các biến dùng in trang, biến PrintPageSetting để thiết đặt trang in, biến StringToPrint để đọc dòng in, biến ... Button1_Click(ByVal sender As Object, _ ByVal e As System.EventArgs) Handles Button1.Click Try AddHandler PrintDocument1.PrintPage, _ AddressOf ModulePrinting.PrintGraphic PrintDocument1.Print() Catch ex As ... nội dung sau: Dim sokytu, sodong As Integer Dim chuoiin As String Dim chuoidinhdang As New StringFormat() 'Định ngh a vùng in d a thiết lập trang Dim vungin As New RectangleF(e.MarginBounds.Left,...
Ngày tải lên: 22/12/2013, 20:17