... corresponding data packet, since such information is contained in the MAC header and is in many instances transmitted at a rate higher than what STAs can support Fortunately, since each data packet sometimes ... that is used in the particular WLAN [25] Although the described mechanism takes advantage of the rate adaptation capability of the network, it is independent of the particular rate adaptation algorithm ... Atlanta, Ga, USA, May 2007 A Sharmat, V Gelaras, S R Singh, T Korakis, P Liu, and S S Panwar, “Implementation of a cooperative MAC protocol using a software defined radio platform,” in Proceedings of...
Ngày tải lên: 21/06/2014, 20:20
... ccaagggagagtggtcaggt ggcaacaaggtagagaggc 317 IL-1β atcactcattgtggctgtgg gtcgttgcttggttctcct 322 IL-10 tgctatgctgcctgctctta gctccactgccttgctctta 405 GAPDH accacagtccatgccatcac tccaccaccctgttgctgta 452 Results ... MG, Ayala A, Cioffi WG, Bland KI, Chaudry IH: Sex steroids regulate pro- and antiinflammatory cytokine release by macrophages after traumahemorrhage Am J Physiol 1999, 277:C35-C42 Angele MK, Ayala ... temperature declines as well DHEA treatment ameliorates or even prevents those detrimental effects in septic animals Our data corroborate the salutary effect of DHEA treatment on clinical status and...
Ngày tải lên: 13/08/2014, 18:22
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"
... Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver ... fairly accurate in determining the placement of subclavian or internal jugular (IJ) vein pulmonary artery (PA) catheter introducer sheaths, but the clinicians were not accurate for clinical determination ... determine the percentage of routine and non-routine radiographs that change management in our medical–surgical ICU, and to determine the specific resultant management changes Materials and methods...
Ngày tải lên: 25/10/2012, 10:45
Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"
... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas Anticancer Res 2003; 23: 3493-8 Yamada H, Maki H, Takeda Y, et al Evaluation of combined nedaplatin and ... predictive of clinical outcome of chemoradiotherapy for stage II/III esophageal squamous cell carcinoma in Japanese Am J Clin Oncol 2007; 30: 252-7 Sakaeda T, Yamamori M, Kuwahara A, et al VEGF G-115 4A ... Yamamori M, Kuwahara A, et al Pharmacokinetics and pharmacogenomics in esophageal cancer chemoradiotherapy Adv Drug Deliv Rev 2009; 61: 388-01 Miki I, Tamura T, Nakamura T, et al Circadian variability...
Ngày tải lên: 26/10/2012, 09:53
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... cultivation Table shows the strains examined in this study MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) MD-1 strain can degrade the microcystin analogs, microcystin-RR, ... (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 (Probe) cggtgaatacgttcycgg ggwtaccttgttacgactt cttgtacacaccgcccgtc Suzuki et al., ... and Water Quality., 13, 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated...
Ngày tải lên: 05/09/2013, 10:15
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... aeration rates Formation of Aerobic Granular Sludge by Controlling Surface Loading and Aeration Rates Surface loading and aeration rates were initially set at 1.2 m3/m2/d and 0.30 L/min, respectively, ... reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling adequate surface loading and...
Ngày tải lên: 05/09/2013, 10:15
Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond
... REFERENCES APHA, AWWA and WEF (1998) Standard Methods for the examination of water and wastewater, 20th edition, APHA, Washington Akiyama M (ed) (1996) Algae in Lakes Shinjiko and Nakaumi, Research ... Cormorants (Phalacrocorax carbo), Japanese Journal of Limnology, 71(1), 19-26 (in Japanese) Ogawa H., Kobayashi S., Nakayama K., Jin K., Igarashi S., Mikami H., Sakata K and Tsuzuki T (1997) Uric acid ... decreased rapidly and was less than 400 kg in April 2000, which was term A again Seasonal Changes in Water Quality The seasonal changes in water quality are shown in Fig TN concentration of 3.0...
Ngày tải lên: 05/09/2013, 10:15
Optimum feeding rate of solid hazardous waste in a cement kiln burner
... types of chemical and hazardous wastes vary greatly, it is difficult to specify a typical analysis and generalize about the impacts of burning of chemical and hazardous waste Some researchers have ... determination of proximate analysis, heating value, bulk density and particle size distribution The proximate analysis was carried out using a Las Navas Automatic Multiple Sample Thermogravimetric ... t/hr (i.e a total raw meal feeding rate of 221 t/hr) A slight decrease in free lime could be observed, indicating that a reduction of 10 t/hr in raw meal feeding rate was actually more than required...
Ngày tải lên: 05/09/2013, 15:28
A computational study to investigate the effects of insulation and EGR in a diesel engine
... [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed compression-ignition engine International ... worked as a Professor and Head of department in the Department of Mechanical Engineering, Vidya Vikas Institute of Technology, Andhra Pradesh, India He has 14 years of teaching and research experience ... Engines from Osmania University, Hyderabad, India in January 2009 He is presently working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also...
Ngày tải lên: 05/09/2013, 16:11
Hegel’s Phenomenology of Spirit - post-Kantianism in a newv ein
... eventful and particularly traumatic He was unable to land a salaried position; the Napoleonic wars in Germany led to a rapid in ation in prices that diminished almost daily the worth of what was left ... normatively in play in the kind of giving and asking for reasons in modern social practice Hegel’s invocation of a “Christian” way of life in that regard was done quite purposely, since it raised ... giving and asking for reasons, therefore, was an ongoing series of social negotiations against a background of taken-forgranted meanings, with everything in the negotiations being up for grabs...
Ngày tải lên: 01/11/2013, 08:20
Tài liệu Organic matter distribution of the root zone in a constructed subsuface flow wetland pptx
... matter (OM) is the organic fraction of soil, including wastewater pollutants, plant roots, animal and plant residues, and microbial biomass OM influences the chemical and physical properties of ... Materials and methods Sand sampling was done during January 2007 in the experimental constructed subsurface flow wetland (CSFW) located at Campus I of Can Tho University (Figure 1) The main part of ... translated a new insight to adjusted design parameter of constructed wetland in tropical countries for domestic wastewater treatment The linear decreasing OM distribution to the increasing vertical and...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Báo cáo khoa học: Destabilization of psychrotrophic RNase HI in a localized fashion as revealed by mutational and X-ray crystallographic analyses pdf
... temperature data on the basis of a least-squares analysis The enthalpy (DHm) and entropy (DSm) changes for thermal denaturation at Tm were calculated by van’t Hoff analysis X-Ray diffraction data ... extension: tailor-made genes using the polymerase chain reaction Biotechniques 8, 528–535 34 Kanaya S, Katsuda C, Kimura S, Nakai T, Kitakuni E, Nakamura H, Katayanagi K, Morikawa K & Ikehara M (1991) ... interactions Alive and well in proteins J Biol Chem 273, 15458–15463 Kashiwagi T, Jeanteur D, Haruki M, Katayanagi M, Kanaya S & Morikawa K (1996) Proposal of new catalytic roles for two invariant...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: Prediction of missing enzyme genes in a bacterial metabolic network Reconstruction of the lysine-degradation pathway ofPseudomonas aeruginosa doc
... predicting PA0266 as a putative 5-aminovalerate aminotransferase and PA0265 as a putative glutarate semialdehyde dehydrogenase Recently, a report has suggested candidate genes for 5-aminovalerate aminotransferase ... aminotransferase and glutarate semialdehyde dehydrogenase in the lysineA PA0266 2-Oxoglutarate B PA0265 Glutarate semialdehyde 5-Aminovalerate NADP+ Glutamate NADPH Absorbance at 340 nm 0.20 a ... cloning for PA0265 were as follows: 5’-GGAATTCCATATGCAACT CAAAGATGCCAAGCTG)3’ and 5’-CCCAAGCTTGA TACCGCCCAGGCAGAGGTACTTG-3’ The primers used for the PCR cloning of PA0266 were as follows: 5’-GGAATTCCATATGAGCAAGACCAACG...
Ngày tải lên: 07/03/2014, 09:20
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... CoA CoB CoC DaB EaA EaB EsB FhA FhB HaA HaB HoA HoB HoC HvB HvC MaA MaB MaC MbA MbB MbC Md MhB MhC MhD Mn MoA MoB MrB Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou ... kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket formation Residuum originating...
Ngày tải lên: 08/03/2014, 23:20
a study on the impact of cost reduction measures in a chieving the competitive advantages in footwear industry
... considered as a set of practice and body of knowledge that its primary tasks are recording transaction, keeping financial record, reporting and analyzing financial information to managers, and sometimes ... accounting information to unify in a general accounting system It is useful for manager as well as companies 2.1.2 The main functions of accounting Accounting always plays a vital role in organization’s ... Analysis of the primarily reserve of material situation in 2010 of Thuong Dinh Company Ltd 46 viii LIST OF ABBREVIATIONS ASEAN Association of South - East Asian Nation APEC Asia...
Ngày tải lên: 13/03/2014, 14:20
research on awareness and implementation of corporate social responsibility in a multinational company in vietnam case study nestle vietnam
... can thereby have an inclusive financial, commercial and social approach, leading to a long term and strategy minimizing risks linked to uncertainly 1.1.3 CSR in multinational companies operating ... implementation, CSR reporting of CSR in a multinational company operating in Vietnam by asking respondents‟ understanding and opinion From conducting research, it can show the understanding and awareness ... impact” The basing of environmental and social accounting had increased the complexity of the traditional view by embracing both external and internal stakeholders, along with performance viewing...
Ngày tải lên: 13/03/2014, 14:20
Báo cáo " Diffusion behaviour of corrosive solution environments in carbon black filled modified polyethylene linings " doc
... – at 60oC; and c – at 80oC Diffusion data in Table also illustrated influence of carbon black loading on diffusion behaviour of water into the polymers As seen in Table 2, an increase of carbon ... loading was also influenced on diffusion characteristics The diffusion rate and saturation value increased with increasing carbon black content As mentioned in previous part, an increase of carbon ... 20 30 40 50 Square root of time, (h0.5 ) 60 0.6 % carbon black loading % carbon black loading % carbon black loading 0.2 0.0 0.8 0.4 % carbon black loading % carbon black loading 0.1 1.0 70 0.0...
Ngày tải lên: 14/03/2014, 13:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... performing basic translations, but also for establishing and maintaining social relationships In addition, Chaney (1998:13) indicates that speaking is the process of building 16 and sharing meaning ... attitude of students and teachers toward English teaching and learning in general and a speaking lesson in particular To get more information about the situation of teaching speaking skill in 9th ... attractive than the others because it attracts a lot of participants in a class and makes a class more interesting” a student said Playing games gives students relaxing times and way to understand...
Ngày tải lên: 15/03/2014, 10:03
Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt
... of speakers’ intentions; a pair of a current intention and a next intention) that are extracted from a sequence of utterances in a current dialogue • Domain knowledge-level feature: In a goaloriented ... such as clue words, previous intentions, and a current state of a domain frame Statistical prediction of speakers’ intentions 2.1 Generalization of speakers’ intentions In a goal-oriented dialogue, ... (Goddeau, 1996), and a plan-based model (Litman, 1987) However, a finite-state model has a weak point that dialogue flows should be predefined Although a plan-based model can manage complex dialogue...
Ngày tải lên: 17/03/2014, 02:20
Army Life in a Black Regiment ppt
... this again The ruined town of St Mary's had at that time a bad reputation, among both naval and military men Lying but a short distance above Fernandina, on the Georgia side, it was occasionally ... suddenly-There was a trampling of feet among the advanced guard as they came confusedly to a halt, and almost at the same instant a more ominous sound, as of galloping horses in the path before us ... luxury of molasses-and-water, a barrel per company, ten in all Liberal housekeepers may like to know that for a barrel of water we allow three gallons of molasses, half a pound of ginger, and a quart...
Ngày tải lên: 17/03/2014, 16:20