Silverlight 4 Business Intelligence Software docx
... Chapter continues to build on the visual intelligence topic by showing how to enhance data visualizations with features to turn them into analytical tools This chapter will show you how to create advanced ... how to use Blend’s dynamic data feature to quickly create and add data to UI functionality without having to spend time architecting databases and services This is a powerful tool to prototype ... are not meant to be an in-depth dive into each technology Each of these topics could easily have its own book dedicated to it! I encourage you to more research on any topic you want to understand...
Ngày tải lên: 17/03/2014, 19:20
... field surveying was used to determine the sampling frame in the camps Coordinate grids, main and secondary roads were used as boundaries to divide camps into equal sampling sectors Instrument The ... given in the arm to reproductive age women that continued to hurt for greater than to days International Medical Corps, June 2005 Statistical Analysis The data were analyzed using STATA statistical ... (82/1864) with symptoms of acute respiratory infection Only thirty-five percent of respondents (445/1273) knew how to mix oral rehydration solution and less than 30% (354/1274) had access to oral rehydration...
Ngày tải lên: 14/03/2014, 14:20
... could not rely totally on it or get unreasonable profits and be able to cause distortions of trade Thirdly, to modify the subsidies given to some industries such as automobile and motorbike manufacturers ... as the WTO allow their Members to apply subsidy measures in some certain cases, especially, subsidies may apply to sectors For example, the subsidies would be applied to agricultural sector Fel! ... years after the time Vietnam become a Member of the WTO In order to get accession to the WTO and to implement its commitments as a Member of the WTO, almost all the laws and policies of Vietnam were...
Ngày tải lên: 18/08/2014, 12:35
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... at 5°C for 80 and then subjected to silver staining (Dai-ichi Kagaku, Tokyo, Japan) The electrophoresis parameters were set according to the manufacturer’s protocol Sequencing analysis Two oligonucleotides ... (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to- 895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The PCR products were purified using a Microcon ... was substantial and independent of other factors [18] Unfortunately, we were not able to obtain samples to measure plasma BNP and ANP levels, due to the difficulty in obtaining written informed...
Ngày tải lên: 26/10/2012, 10:04
Who Are America’s Poor Children? Examining Health Disparities Among Children in the United States ppt
... collective investments to reduce exposure to known toxins, to provide families with the means to access high-quality, responsive care to promote healthy behaviors, and to remediate illnesses ... shows these two indicators for young children (ages to 5) and older children (ages to 17) Among both age groups, poor children are less likely to have a place to go when sick and to have had a check-up ... exposure to existing toxins in familiar settings, such as exposure to second-hand smoke at home Children exposed to second-hand smoke are at increased risk of developing a range of respiratory illnesses,...
Ngày tải lên: 05/03/2014, 12:20
European Women’s Lobby Position Paper: Women’s Health in the European Union ppt
... with many of the factors contributing to poor health as it deprives individuals of the possibility to satisfy basic needs and rights, namely to achieve sufficient nutrition, to obtain remedies ... necessary measures in order to prevent any further discrimination against women in access to health-care and health services Women need to be informed in order to be able to denounce such acts of ... demand In several other Member States, like Cyprus, the Czech Republic, Estonia and Malta, plans to make the vaccine available to the public have been discussed but 11 EUROSTAT, Key Figures on Europe,...
Ngày tải lên: 05/03/2014, 15:20
Gender inequality in health among elderly people in a combined framework of socioeconomic position, family characteristics and social support doc
... responses to the following prompts : ‘ I get invitations to go out and things with other people’, ‘ I get chances to talk to someone about problems at work or with my housework’, ‘ I get chances to ... services to the family of the dependants, the expansion of home visits to elderly people by health professionals, and the adaptation of housing to the ageng process (e.g installing elevators in ... period and is expected to rise to 30 per cent by 2050 Moreover, the biggest population increase affects those aged over 80 years, the number of whom is expected to double by 2050 to 51 million citizens...
Ngày tải lên: 22/03/2014, 14:20
Budget Impasse Hinges on Confusion among Deficit Reduction, Tax Increase, and Tax Reform: An Economic Analysis of Dual Capacity and Section 199 Proposals for the U.S. Oil and Gas Industry ppt
... times by the desire to advance social agendas Similar to tax rate increases, only to the extent to which tax reform could lead to greater tax revenues the two concepts align to advance the overall ... contributed about $1 trillion to the U.S economy.37 In order to measure how the proposed tax policies affect this sector, it is helpful to break the sector down into its economic subparts U.S ... Unlike Section 199, the current administration intends to make the changes to Dual Capacity applicable to all taxpayers Nevertheless, the energy sector will be severely affected since U.S oil and gas...
Ngày tải lên: 31/03/2014, 07:20
báo cáo hóa học: " Primary Sjögren''''s Syndrome: health experiences and predictors of health quality among patients in the United States" potx
... all SF-36 scales compared to both patients with RA and PSS To date, the relative effects of pervasive symptoms including fatigue, pain, psychological distress and xerostomia on health quality are ... according to the 2002 AECG criteria [11] were recruited through nine highvolume clinics across the United States (referred to as "PhysR-PSS") To protect the patient's identity, the surveys were sent to ... the critical predictors (i.e minus age and disease duration) entered into their own regression equations, and once with all of the critical predictors and covariates entered into a single multivariate...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " Incidence of Raynaud''''s phenomenon in relation to hand-arm vibration exposure among male workers at an engineering plant a cohort study" doc
... subtracted by the number of years with reported symptoms) or to being censored (last follow up without symptoms) The time to first occurrence of symptoms was regardless of side (right or left hand) ... male office workers were randomly invited into the study, only three declined to enter the study All the male 112 manual workers at the plant were invited to participate (there was only females employed ... baseline Time to event was computed as the number of years from baseline to the first follow up with RP (5, 10 or 15 years) or to being censored (still no RP at last follow up) Thus a worker to be included...
Ngày tải lên: 20/06/2014, 00:20
báo cáo hóa học:" Validation of the Self-Management Ability Scale (SMAS) and development and validation of a shorter scale (SMAS-S) among older patients shortly after hospitalisation" doc
... was taken into account when interpreting the results of confirmatory factor analysis Confirmatory Factor Analysis All items (table 1) had factor loadings above 0.40 on the intended factor except ... the questionnaire and to test whether the relationship between observed variables and their underlying latent constructs existed, confirmatory factor analysis was executed using the LISREL program ... given its sensitivity to sample size Together the analyses showed that the underlying factors of the items were indeed the dimensions of abilities and well-being A one-factor model without distinguishing...
Ngày tải lên: 20/06/2014, 16:20
báo cáo hóa học:" Interpretation of response categories in patient-reported rating scales: a controlled study among people with Parkinson''''s disease" pot
... (MANOVA) [31] was used to compare VAS values from PD and control respondents If no significant differences between groups were identified, the pooled data was used to explore (using nonparametric ... There are a number of aspects that need to be taken into consideration when interpreting the results presented here First, the appropriateness of using VAS to evaluate participants' interpretation ... function when administered to a particular group of people, and to overcome the assumption of equal intervals in the construction of total scores Specifically, the polytomous Rasch measurement...
Ngày tải lên: 20/06/2014, 16:20
A Critical Examination Of The Position Of Mr. Darwin''''s Work ppt
... Newton, or a Kepler, those great philosophers, whose discoveries have been of the profoundest benefit and service to all men, to say to them —"After all that you have told us as to how the planets ... prepared to show that the assumed causes of the phenomena are competent to produce such phenomena as those which we wish to explain by them; and in the last place, we ought to be able to show ... palaeontology shows us many facts which are perfectly harmonious with these observed effects of the process by which Mr Darwin supposes species to have originated, but which appear to me to be totally...
Ngày tải lên: 28/06/2014, 19:20
English Grammar''''s archiveAdverbs- Position in sentenceQ1 pdf
Ngày tải lên: 26/07/2014, 06:20
LINEAR POSITION SENSORS.LINEAR POSITION SENSORSTheory and ApplicationDAVID S. NYCEA JOHN docx
... The operator will be able to achieve this to within some level of tolerance That tolerance will become part of the calibrated accuracy specification, in addition to any allowance made due to the ... load resistor within the customer’s application to convert the current into a voltage (see Figure 2.13) A 4- to 20-mA transducer is commonly used with a precision 250-W load resistor to convert ... exercised from zero, to full scale, to zero, then to half scale A data point is taken at the last position Then the movement of the core is continued to full scale, to zero, then to half scale again...
Ngày tải lên: 09/08/2014, 11:20
báo cáo khoa học: ""For someone who''''s rich, it''''s not a problem". Insights from Tanzania on diabetes health-seeking and medical pluralism among Dar es Salaam''''s urban poor" ppsx
... sat to herself She appeared introverted quite opposite to Helen who approached us at the clinic, wanting to talk Fatima could not afford the medical check-up and only attended the doctor to obtain ... more time taking care of their illness in the popular sector than in the professional sector or in the folk sector and the popular sector can therefore be conceived as the most significant arena ... accompanying them We had been talking to a few patients with the assistance of our interpreter when Helen approached us and wanted to talk to us One of the things she wished to express was that diabetes...
Ngày tải lên: 11/08/2014, 14:21
Waist circumference, abdominal obesity, and depression among overweight and obese U.S. adults: national health and nutrition examination survey 2005-2006" doc
... for “having the symptoms for nearly every day” Their scores for each item were then added to produce a total depression severity score, and the cutoff point of ≥ 10 was used to identify participants ... up to four readings of systolic and diastolic blood pressure were obtained from participants in the mobile examination centers The average of the last two measurements of systolic or diastolic ... major depressive symptoms or moderate -to- severe depressive symptoms were estimated by conducting logistic regression analyses to test associations between depressive symptoms and waist circumference...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Seroprevalence and risk factors of Kaposi''''s sarcoma-associated herpesvirus infection among the general Uygur population from south and north region of Xinjiang, China" docx
... importance to investigate KSHV seroprevalence and transmission mode-associated behaviors in Xinjiang, to gain a greater epidemiological understanding of these diseases, and to then be able to apply ... used to identify independent risk factors for KSHV infection in total study population (Table 2) In this model, KSHV was significantly more prevalent in individuals aged ≥55 years compared to those ... educational level (P=0.020), from 17.7% in those educated to junior high school level, to 24.3% in those educated to elementary school level, and to 28.3% in those who were illiterate/semiliterate An...
Ngày tải lên: 11/08/2014, 21:22
Vietnam’s aging rate among fastest in the world
... What We’ll Cover Today Your logo here Overview of Vietnam Population Your logo here Statistic of population change from 1960 -2010 Challenges to be addressed o income insecurity ... elderly suffer from various illnesses • Each elderly people got 2.69 diseases SOLUTION What to Enhance people’s awareness of population structure and quality Reduce the proportion of early ... health care for the elderly and increasing their income Concerned agencies should also take measures to deal with ageing population Your logo here Reference Wikipedia/vietnam_population...
Ngày tải lên: 06/10/2014, 05:44