... retrieves the contents of these tables, by using the wizards provided with Visual Studio 2005 Create a data source Using Visual Studio 2005, create a new project by using the Windows Application template ... Web service Using an object or a Web service as a data source is beyond the scope of this book, but we will describe how to create and use Web services in Chapter 28, “Creating and Using a Web ... connect to the database Some data sources can be accessed by using more than one data provider For example, you can connect to SQL Server by using the NET Framework Data Provider for SQL Server, or...
Ngày tải lên: 24/12/2013, 09:16
... candidates, the system evaluates nearby blend candidates using a higher-dimensional distance function The final blend candidates are blended using both a rotational and positional interpolation scheme ... THE DELAUNAY DATABASES Sybren A St¨vel u adjustments not change the parameters of the step The cleanup is done automatically and does not require any manual action 4.2 The Delaunay Databases To ... of recording natural motions, but by itself it is not suitable for interactive environments as using the motion capture data in itself can be compared to playing back a recording To interpret,...
Ngày tải lên: 17/03/2014, 12:20
Báo cáo hóa học: " Analysis of the nucleotide sequence of the guinea pig cytomegalovirus (GPCMV) genome" ppt
... I fragments using the map coordinates originally described by Gao and Isom [16] These sequences were compared to the BAC sequence to facilitate assembly of a full-length contiguous sequence Since ... origin sequences into the Hind III "N" region of the viral genome, sequence obtained from this specific restriction fragment cloned in pBR322 was utilized for assembly of the final contiguous sequence; ... [17], DNA sequence from a plasmid containing the full-length Hind III "D" fragment was similarly obtained, and used for assembly of the final contiguous sequence The GPCMV genomic sequence has...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa hoc:"The 5S rDNA of the bivalve Cerastoderma edule: nucleotide sequence of the repeat unit and chromosomal location relative to 18S-28S rDNA" doc
... clone were sequenced by the dideoxy-sequencing method with the AutoRead kit (Pharmacia) Automatic sequencing was performed on an A.L.F express sequencer (Pharmacia) Sequences were aligned using CLUSTAL ... clones, ignoring the sequence corresponding to primer A in clones Cel and Ce2 Several sequences of the eukaryotic 5S rDNA involved in the transcription can be identified in the sequences obtained ... !3!, i.e in intra-specific comparisons a high degree of sequence similarity is usually observed between independent repeats Thus, 5S rDNA sequences are regarded as potentially useful in revealing...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: " Restriction Site Tiling Analysis: accurate discovery and quantitative genotyping of genome-wide polymorphisms using nucleotide arrays" pptx
... information required EST, 454 or genome sequence EST or RAD-tag library for array synthesis EST or genome sequence to map short sequence reads EST, 454 or genome sequence Polymorphism identification ... codon We performed PCR amplification using a touchdown protocol for all primer pairs, from 62 to 48°C for 40 cycles We sequenced amplified DNA using an ABI3100 sequencer Data visualization and analyses ... while five out of five sequences matched the tile sequence as predicted Genes with indels could be top candidates for further study as they likely result in an amino acid sequence change, possibly...
Ngày tải lên: 09/08/2014, 20:21
Báo cáo khoa học: "Comparative analysis of complete nucleotide sequence of porcine reproductive and respiratory syndrome virus (PRRSV) isolates in Thailand (US and EU genotypes)" pot
... Table 3: Pair-wise sequence comparison of full-length nucleotide sequences of PRRSV from Thailand and those of EU and US strains Pair-wise sequence comparison of PRRS viruses (% nucleotide identity)* ... Phylogenetic relationship of PRRS viruses, ORF sequences Phylogenetic relationship of PRRS viruses, ORF sequences ORF5 sequences were used for phylogenetic analysis using MEGA program applying NJ algorithm ... chromatograms of nucleotide sequences of each PCR products were rechecked and validated to ensure the type and position of nucleotide and amino acid changes in PRRS genome The sequence alignment...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo khoa học: Nucleotide binding to human UMP-CMP kinase using fluorescent derivatives ) a screening based on affinity for the UMP-CMP binding site potx
... anthraniloyl (Mant) nucleotides (Mant-ATP [15] and cytidine diphosphob-(NÂ-methylanthraniloylaminobutyl)-phosphoramidate (MABA-CDP ) [16]) as uorescent probes to monitor the binding of nucleotides to ... either ribonucleoside or deoxyribonucleoside monophosphate [18] Cytidine nucleotides had higher afnities than uridine nucleotides, as reported for the Dictyostelium enzyme The comparison between ... and uridine monophosphates in Table is in agreement with the preference for ribonucleotides rather than deoxyribonucleotides The 56-fold difference in KD values was presumably due to the interaction...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: A distinct sequence in the adenine nucleotide translocase from Artemia franciscana embryos is associated with insensitivity to bongkrekate and atypical effects of adenine nucleotides on Ca2+ uptake and sequestration pdf
... of the known ANT nucleotide sequences from other species and the partial A franciscana ANT sequence RACE PCR products were sequenced, and the final assembled 1213-bp nucleotide sequence was submitted ... are insensitive to BKA Resistance to BKA may be a direct consequence of the unique sequence of the Artemia ANT Results Effect of adenine nucleotides on Ca2+ sequestration of Artemia mitochondria ... ANT sequence (EF660895.1) and significant similarity (69–76%) to the sequences of human, bovine, rat, mouse, Xenopus and Drosophila isoforms (see below, and Fig 7) The deduced amino acid sequence...
Ngày tải lên: 29/03/2014, 00:20
benjamin van vliet - 2004 - modeling financial markets using visual basic net and databases to c
... related books and websites, please click here Team-LRN MODELING FINANCIAL MARKETS Using Visual Basic.NET and Databases to Create Pricing, Trading, and Risk Management Models BENJAMIN VAN VLIET ... Basic.NET (VB.NET) and databases It is about modeling financial instruments in code and putting the pieces, or models, together to create an automated trading or risk management system using a programming ... higher-level language such as C/Cþþ or Java In addition you will need to understand how databases are constructed and accessed using computer code to financial research and develop trading and risk management...
Ngày tải lên: 23/04/2014, 16:19
Báo cáo sinh học: " Cloning of full genome sequence of hepatitis E virus of Shanghai swine isolate using RACE method" docx
... CTAAGACCTTCTTTGTTCTGCC GTTTTCCCAGTCACGACTTTTTTTTTTTTTTT Position and nucleotide sequence of oligonucleotide primers for PCR The nucleotide position is in accordance with the SH-SW-zs1 isolate in ... human; EF077630, China, swine; AB197674, human Phylogenetic analysis Using Clustal × 1.8, multiple alignments of nucleotide sequences was carried out The phylogenetic status SHSW-zs1 isolate was ... Figure sequence of 39 HEV isolates MEGA software depicting genotypic status of SH-SW-zs1 on the basis of full-length genome Phylogenetic trees constructed using Phylogenetic trees constructed using...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Cloning of full genome sequence of hepatitis E virus of Shanghai swine isolate using RACE method" pptx
... CTAAGACCTTCTTTGTTCTGCC GTTTTCCCAGTCACGACTTTTTTTTTTTTTTT Position and nucleotide sequence of oligonucleotide primers for PCR The nucleotide position is in accordance with the SH-SW-zs1 isolate in ... human; EF077630, China, swine; AB197674, human Phylogenetic analysis Using Clustal × 1.8, multiple alignments of nucleotide sequences was carried out The phylogenetic status SHSW-zs1 isolate was ... Figure sequence of 39 HEV isolates MEGA software depicting genotypic status of SH-SW-zs1 on the basis of full-length genome Phylogenetic trees constructed using Phylogenetic trees constructed using...
Ngày tải lên: 20/06/2014, 01:20
Using Visual Basic NET Databases to Create Pricing Trading R_3 pot
... of the publisher using the WithEvents keyword Fire the event in the publisher using the RaiseEvent keyword Create a method in the subscriber that will run when the event is fired using the Handles ... built-in function MMult() F I G U R E 8.4 USING ARRAYS FOR TREES Here we will show a simple example using a jagged array to price an American call option using a binomial tree The call option has ... initial value in the tree, 100, is calculated using the formula 100 ¼ S0 Á D0 Á U The two prices after one step forward, 107.43 and 93.09, are found using 107:48 ¼ S0 Á D0 Á U 93:04 ¼ S0 Á D1 Á...
Ngày tải lên: 20/06/2014, 23:20
Using Visual Basic NET Databases to Create Pricing Trading R_4 docx
... types of databases used in financial markets: operational databases and analytical databases Operational databases store dynamic data such as portfolio and position information Analytical databases ... not In the long run, we are much better off There are far more advantages to using a database than disadvantages Using databases and VB.NET programs gives us much more control and security when ... understanding of databases, we will see that they can become very powerful, full-scale client-server relational database management systems So it is important that we learn how relational databases...
Ngày tải lên: 20/06/2014, 23:20
Using Visual Basic NET Databases to Create Pricing Trading R_5 doc
... relational databases are superior to Excel as a way to store and manage data Team-LRN Relational Databases 197 The database field has its own language that we must learn before we can begin creating databases ... interact with databases in VB.NET programming code using ActiveX Data Objects (ADO) ADO is a proprietary set of Microsoft objects that allows developers to access relational and nonrelational databases, ... creating new relational databases necessitates the use of a design methodology We very briefly reviewed the seven steps of a well-known methodology There are three Access databases included on the...
Ngày tải lên: 20/06/2014, 23:20
Using Visual Basic NET Databases to Create Pricing Trading R_6 pdf
... remainder of the chapter, SELECT statements should be executed using the first button, and all other transactions should be executed using this new, second button The SQL INSERT statement enables ... within the collection using the Count and Item properties and the Add and Remove methods of the Collection class Furthermore we can iterate through the elements in a collection using a For Each ... and ROLLBACK statements are part of a very important and versatile Oracle capability to control sequences of changes to a database You should consult the documentation of your particular RDMBS...
Ngày tải lên: 20/06/2014, 23:20
Using Visual Basic NET Databases to Create Pricing Trading R_8 potx
... object, found in the System.XML namespace, gives us fast, read-only access to an XML stream So by using an XMLTextReader to read a stream, we will be implementing a form of SAX parser to make sure ... VB.NET’s System.Net and System.XML namespace objects to communicate over the Internet with a server using the FMML protocol In the following chapter we will look at some real-world XML protocols used ... widespread over the last decade, communication between institutional trading firms is still often done using such last-millennium technologies as the telephone Over the coming years, the advantages of...
Ngày tải lên: 20/06/2014, 23:20
Using Visual Basic NET Databases to Create Pricing Trading R_9 potx
... subtype of a use case Sequence Diagram A sequence diagram describes the flow of messages as they are passed from object to object Whereas class diagrams describe a static structure, sequence diagrams ... between classes Figure 20.17 is a sequence diagram for running a Monte Carlo simulation The object initiating the sequence of messages is a Form1 GUI window The sequence of events proceeds as we ... previous sequence diagrams do, focus on the roles that objects play in the overall scheme, as opposed to the sequence of messages being sent Each message in a collaboration diagram has a sequence...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " Research Article Carrier Frequency Offset Estimation for Multiuser MIMO OFDM Uplink Using CAZAC Sequences: Performance and Sequence Optimization" ppt
... floor using CAZAC sequences is more than 10 times smaller than that using the m sequence The performance of CFO estimation using different CAZAC sequences is compared in Figure Here we fix the sequence ... evaluate the performance of the CFO estimation using CAZAC sequences We first compare the performance using CAZAC sequences with the performance using two other sequences with good correlation properties, ... at three classes of CAZAC sequences, namely, the Frank-Zadoff sequences [18], the Chu sequences [19], and the S&H sequences [20] The Frank-Zadoff sequences exist for sequence length N = K where...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Research Article On Some New Sequence Spaces in 2-Normed Spaces Using Ideal Convergence and an Orlicz Function" pptx
... that X, ·, · is a 2-Banach space if every Cauchy sequence in X is convergent to some x in X Quite recently Savas 15 defined some sequence spaces by using Orlicz function and ¸ ideals in 2-normed ... paper, we continue to study certain new sequence spaces by using Orlicz function and ideals in 2-normed spaces In this context it should be noted that though sequence spaces have been studied before ... Further, let p pk be a bounded sequence of positive real numbers By S − X we denote the space of all sequences defined over X, ·, · Now, we define the following sequence spaces: W I λ, M, p, ,...
Ngày tải lên: 21/06/2014, 07:20
Querying, Managing, and Administering Databases Using SQL Server 2005 doc
... Graduation B Applicant Table After Using the UNPIVOT Operator 1.4 Querying, Managing, and Administering Databases Using SQL Server 2005 NIIT The syntax for using the UNPIVOT operator is: SELECT ... the book Querying and Managing Data Using SQL Server 2005: Using Functions to Customize the Result Set NIIT Querying, Managing, and Administering Databases Using SQL Server 2005 2.3 From the Expert’s ... section in Chapter of the book Administering Databases using SQL Server 2005: Upgrading to SQL Server 2005 NIIT Querying, Managing, and Administering Databases Using SQL Server 2005 6.5 From the Expert’s...
Ngày tải lên: 27/06/2014, 12:20