using methods and variables from a java class

... Step 12 Trace a local host name or IP address Try using the tracert command with a local host name or IP address It should not take long because the trace does not pass through any routers ... a point where one network connects to another network and the packet was forwarded through Step 11 Trace other IP addresses or domain names Try tracert on other domain names or IP addresses and ... Without name resolution, the ping would have failed because TCP/IP only understands valid IP addresses, not names If the ping was successful, it means that connectivity and discovery of IP addresses...

Ngày tải lên: 11/12/2013, 13:15

... Trace a local host name or IP address Try using the tracert command with a local host name or IP address It should not take long because the trace does not pass through any routers 5-6 CCNA 1: ... a point where one network connects to another network and the packet was forwarded through Step 11 Trace other IP addresses or domain names Try tracert on other domain names or IP addresses and ... would have failed because TCP/IP only understands valid IP addresses, not names If the ping was successful, it means that connectivity and discovery of IP addresses can be done with only a hostname...

Ngày tải lên: 21/12/2013, 19:15

... Lucilia cuprina Anopheles dirus Bombyx mori Manduca sexta Anopheles gambiae Anopheles gambiae Blattella germanica Drosophila melanogaster Manduca sexta Anopheles gambiae Anopheles gambiae Anopheles ... Removal of contaminating agents from the crude RNA extract was performed using a Qiagen RNeasy kit (Qiagen, Inc., Valencia, CA, USA) First-strand cDNA synthesis was carried out using a BD SMART RACE ... Udomsinprasert R, Pongjaroenkit S, Wongsantichon J, Oakley AJ, Prapanthadara L -A, Wilce MCJ & Ketterman AJ (2005) Identification, characterization and structure of a new Delta class glutathione transferase...

Ngày tải lên: 23/03/2014, 09:21

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA : Os s.33510.1.S2 2_at P I F S P I F S GTAGATTTGTAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT GTAGATTTATAGAGAAACAACCCTGTAAATCCGGTGAT ... TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTAACTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA : 100 I TGAAGTTGAGTTGTCTTGAAGTGGGTCACTATGAAAACTATCAGCTGTCATTATACTTATCTGGGAAAATGCAATGAAGTTATTTTCTGATTTCTCCTGA...

Ngày tải lên: 12/08/2014, 03:20

... mail service, on the other hand, is a large, complex piece of software that accepts data (mail) from and returns data to the client, as well as reads and stores data and configuration information ... that allowed an organization (or a person) to request an Internet address from a central authority and then expand on that name using their own authority Thus was born the Internet Domain Name ... can, maintain web page usernames and passwords separately from operating system usernames and passwords Log web access, and look for unusual patterns (excessive 404 errors, etc.) Security characteristics...

Ngày tải lên: 29/09/2013, 13:20

... (Tables and 2) revealed the same linkage pattern and sugar sequence as in the polysaccharide of P penneri (structure 1) and one additional sugar residue (a- GlcpII) attached at position of GalNAcI ... RESULTS AND DISCUSSION Structure of the O-speci®c polysaccharide from P penneri strain Sugar analysis of the polysaccharide from P penneri revealed glucose and galactose in almost equal amounts as ... inter alia, signals for four anomeric protons at d 4.59±4.96 and two N-acetyl groups at d 2.05 and 2.06 Therefore, the polysaccharide has a tetrasaccharide repeating unit containing one residue each...

Ngày tải lên: 17/03/2014, 17:20

Ngày tải lên: 23/03/2014, 22:21

... destroyed viable language and cultural groupings in the Americas and Australasia It is doubtful that economic globalization would have the same catastrophic impact in Europe, Asia and Africa For this ... "devastating effect of the process of language shift on actual individuals and their familial and social relations." Thirdly, in United States, Canada, the United Kingdom, Australia, New Zealand ... to a broader social and political context they are existing in and serving Pennycook [1] assumed that: The view of language or of language learning cannot be an autonomous one that backs away from...

Ngày tải lên: 28/03/2014, 11:20

... National Health and Medical Research Council Grants 179805 and 79839, a grant from the AlcoholRelated Medical Research Grant Scheme of the Australian Brewers' Foundation and a grant from the Australian ... sociodemographic characteristics were undertaken separately for age group and compared within and between genders Analysis of continuous variables required One-way Analysis of Variance (ANOVA); Pearson's ... Psychiatry Access article References Commonwealth Department of Health and Aged Care: LIFE: areas for action Canberra: Commonwealth of Australia; 2000 Australian Bureau of Statistics: 3303.0 Causes...

Ngày tải lên: 11/08/2014, 16:22

... ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... is actually great variation in the way they are realized across languages, institutions and individuals Every time we open a phone call, we must find an appropriate way to various contextual variables ... the familiar "Allo," and they often add their name and the phrase "Qui est a l"appareil?" that is, "Who is on the phone?" In Brazil, after slowly and patiently dialing a number, if you are lucky...

Ngày tải lên: 02/03/2015, 14:37

... ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... anybody learning a foreign language and remains a sensitive area in intercultural encounters, even for those who have mastered the basics of a foreign language and culture Inexperience in dealing ... Communication, and Social Meaning Edited by James E Alatis; Georgetown University Round Table on Languages and Linguistics (GURT) 14 Harmeet Sawhney, George A Barnett (1999), Advances in telecommunications,...

Ngày tải lên: 10/08/2015, 19:52

... examined include: the US and Canada (North America); the United Kingdom and Germany (Europe); India and Pakistan (Asia); Australia and New Zealand (Australia); Kenya and Nigeria (Africa); Argentina ... Essay at a Glance: Research Questions, Variables, Statistical Methods and Main Findings 57 1.5 Essay at a Glance: Research Questions, Variables, Statistical Methods and Main Findings 58 1.6 Essay ... Cross-sectional analysis based on publicly available archival data from 173 countries Growth Theory and Human Capital Theory; Crosssectional analysis based on publicly available archival data from 160...

Ngày tải lên: 09/09/2015, 11:17

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets ... the mathematical optimization strategy and in Alternatives and of the exergoeconomic improvement approach One observes from Table that the three schemes are robust, and that the mathematical optimization, ... Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach for the improvement...

Ngày tải lên: 05/09/2013, 16:30

... comparative entities and predicates (Task 2): Our basic idea for the second task is selecting candidates first and finding answers from the candidates later We regard each of noun words as a candidate ... comparative and superlative POS tags, and some additional keywords Their methods applied Class Sequential Rules and Label Sequential Rules Yang and Ko (2009; 2011) studied to extract comparative ... are represented as a combination of their lexicalization and POS tag After feature generation, we calculate each probability value of all CE-candidates using SVM For example, if a sentence has...

Ngày tải lên: 20/02/2014, 04:20

... 2000-158-CE), Departament de Salut, Generalitat de Catalunya, Spain, and other local agencies and by an unrestricted educational grant from GlaxoSmithKline More information is available at: http://www.epremed.org ... to value their own health state on a visual analogue scale (EQ-VAS) The EQ-VAS records a respondent’s self rated valuation of health status on a scale ranging from (worst imaginable health state) ... each as a dependent variable in a weighted ordinary least square regression, while again controlling for socio-demographic variables (Table 6) It was found that age and German residence were negatively...

Ngày tải lên: 20/06/2014, 15:20

... μPAN ) σb + μb , (1) σPAN where μPAN and μb are the mean of the PAN and MS image band b, respectively, and s PAN and s b are the standard deviation of the PAN and MS image band b, respectively This ... al.[30] to merge Landsat MSS with Return Beam Vidicon (RBV) data and Landsat MSS with Heat Capacity Mapping Mission data In 1988, Chavez et al.[31] used SPOT panchromatic data to “sharpen” Landsat ... Price and spatially adaptive methods, Bayesian-based and super-resolution methods (5) Multiresolution family, which includes generalized Laplacian pyramid, wavelet and contourlet methods and any...

Ngày tải lên: 20/06/2014, 22:20

... the Acoustical Society of Japan, pp 637–638, September 2003 A Sasou, M Goto, S Hayamizu, and K Tanaka, “An autoregressive, non-stationary excited signal parameter estimation method and an evaluation ... singing from a particle or a suffix hardly ever occurs For example, in the following sentence: Bara Ga Sai Ta ¡¡¡ Rose (subject) Bloom (past) “bara ga” and “sai ta” are “bunsetsu”, and a user hardly ... rates (word correct rate and word accuracy) and error rates In the table, “trigram” denotes the results using a trigram language model trained from lyrics in the database The word correct rate...

Ngày tải lên: 22/06/2014, 23:20

... Histogram and standard deviation comparisons (a) , (c), (e) are histograms and standard deviation corresponding to R, G, B color of image 9a; (b), (d), (f) are histograms and standard deviation ... Histogram and standard deviation comparisons (a) , (c), (e) are histograms and standard deviation corresponding to R, G, B color of image 9b; (b), (d), (f) are histograms and standard deviation ... perform the analysis and synthesis on each color separately to build a good color image Fig and are two red color images perceived from two original color image 4a and 4b After passing these images...

Ngày tải lên: 22/07/2014, 02:21

... The amplification of pauA gene was performed with the oligonucleotide primer P38 5' AATAACCGGT TATGATTCCGACTAC 3' and primer P39 5' AAAATTTACTCGAGACTTCCTT TAAGG 3' described by Johnsen et al [34] ... (lane 2, 4, 7), pattern III (lane 3), pattern IV (lane 5), pattern V (lane 6, 8) and pattern VI (lane 9) already been used for characterization of S agalactiae and S porcinus [2,39] Comparable ... bacteria in the lactating bovine mammary gland [40] For S uberis the plasminogen activator gene pauA and the plasminogen activator gene designated as streptokinase gene skc was cloned and sequenced...

Ngày tải lên: 07/08/2014, 17:22

... angle; talus second metatarsal angle A – calcaneal inclination angle, B – calcaneal-first metatarsal angle, C – talo-navicular coverage angle, D – talus-second metatarsal angle Angle A decreases ... height truncated, CIA – calcaneal inclination angle, C1MA – calcaneal first metatarsal angle, TNCA – talo-navicular coverage angle, T2MA – talus-second metatarsal angle Mean differences and 95% confidence ... 0.21 Participant not suitable for x-ray NO YES Is CIA and C1MA and / or TNCA and T2MA radiographic measurements greater than 1SD from the normalarched mean? CIA C1MA TNCA TSMA Males Females Males...

Ngày tải lên: 10/08/2014, 21:23