using color in a drawingarea

Tài liệu Using Indexers in a Windows Application doc

Tài liệu Using Indexers in a Windows Application doc

... class that returns a PhoneNumber and accepts a single Name parameter Implement this indexer in the same way as the first one (again note that PhoneNumber is a struct and therefore always has a ... indexers In the PhoneBook.cs source file, add a public read-only indexer that returns a Name and accepts a single PhoneNumber parameter to the PhoneBook class Leave the body of the get accessor blank ... item in the array that matches The first argument to IndexOf is the array to search through (phoneNumbers) The second argument to IndexOf is the item you are searching for IndexOf returns the integer...

Ngày tải lên: 24/12/2013, 09:16

6 353 0
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM

DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM

... TCE degradation were examined MATERIALS AND METHODS TCE (99+%) was obtained from Aldrich Chemical Co, and the TiO2 used was Degussa P-25, which was mostly anatase and had a BET surface area of 50-m2/g ... in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV concentrating radiation System (Yves et al., 1996) In this process, major toxic ... alone) Figure Schematic diagram of photocatalytic solar reactor - 39 - The dark reaction was initially carried out by injecting a sampling of TCE into the slurry of TiO2 to given a final solution of...

Ngày tải lên: 05/09/2013, 08:40

6 393 0
A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process

A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process

... profile of TAD supernatant and NaAc addition Observed CO2 evolution rates were similar in both cases, and the TAD supernatant VFA estimations are shown in Table Estimations showed a substantial overestimation, ... on the basis of tests using the same batch of sludge sample Acetate and VFAs concentrations were verified using a Hewlett-Packard® 588 0A gas chromatograph, equipped with a flame ionization detector ... sodium acetate concentrations were estimated using this linear correlation and their verification (by gas chromatograph analysis) are shown in Table The estimated error was less than %, in four...

Ngày tải lên: 05/09/2013, 08:40

6 405 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

... the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and to define main decision variables ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with ... steam and process hot water demands are also equality constraints [19] The inequality constraints are represented by the allowable ranges of variation of the decision variables, presented in Table...

Ngày tải lên: 05/09/2013, 16:30

14 594 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... a wind farm of HAWT using GA gives a uniform grid arrangement similar that obtained by Grady et al [2]; this is different than that obtained by Mosetti [1] who obtained a somewhat random arrangement ... of Engineering in department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu ... University in St Louis He received B.S in Mechanical Engineering from Shanghai Jiao Tong University in China in 2008 and M.S in Mechanical Engineering from Washington University in St Louis in 2010 Xiaomin's...

Ngày tải lên: 05/09/2013, 17:03

12 636 1
Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc

Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc

... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... researched information in the development of setting, character, and plot In addition, essays are evaluated for language use, particularly for one or two grammatical items on which the teacher wanted...

Ngày tải lên: 06/09/2013, 05:10

9 668 0
A cross cultural study of using hedges in refusing a request in english and vietnamese

A cross cultural study of using hedges in refusing a request in english and vietnamese

... as a lion As fierce as a tiger As slippery as an eel As slow as a tortoise As slow as a snail As stink as a polecat As thick as ants As wet as a drowned rat Like water off a duck’s back To fight ... legal, and literary It can be said that connotation can be seen as an additional meaning to denotation In general, both connotation and denotation are important to determine word meaning in a ... Piggy bank Raining cats and dogs A bull in a China shop A dark horse To work like a dog An early bird A quiet as a mouse A copy cat 10 Eats like a horse 11 Smell to a rat 12 Talk turkey 13 A book...

Ngày tải lên: 14/12/2013, 00:41

49 742 0
Tài liệu Using XPath to Query Data in a DataSet doc

Tài liệu Using XPath to Query Data in a DataSet doc

... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet da = new SqlDataAdapter("SELECT ... [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); da.Fill(orderDetailTable); ds.Tables.Add(orderDetailTable); ... = new DataSet("Orders_OrderDetails"); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]);...

Ngày tải lên: 26/01/2014, 10:20

4 443 0
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx

Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx

... subtropical rangeland offers predominantly C plants for grazing cattle, milk casein was enriched in 13 C relative to C3 plants Amino acids were added to the C3 and C4 sugar diets to a final concentration ... tested with ANOVA The effect of the amino acid supplement on egg ␦13C was tested in the 1998 data set with ANOVA, including sugar type, day, and the interaction between sugar and amino acids as effects ... two years ␦13C of larval and adult dietary components Samples of larval host plant (including V labrusca, V novae-angliae, and A brevipedunculata from several collection sites) ranged in ␦13C...

Ngày tải lên: 13/02/2014, 16:20

10 434 0
Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

... of mental capacity between savage and civilized man and regarding the mental gap as more apparent than real and due rather to experience and training than to innate factors To paraphrase a recent ... that brain-weight and spiritual capacity and achievement keep equal pace and that a large and heavy brain of itself betokens a man highly endowed in both respects, a small and light brain a man ... denying everything as a whole, affirms everything in detail that is maintained in the preceding chapters Inasmuch as the Address of this savant may be regarded as the ne plus ultra of pro-African...

Ngày tải lên: 19/02/2014, 11:20

90 476 0
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... automatically transcribed dialog corpora by modeling dialogs within a probabilistic framework that accounts for transcription errors in a principled way This method may lead to many interesting ... future applications, such as continuous learning of a user model while the dialog system is on-line, enabling automatic adaptation References −5 Truth Manual EM Automatic −6 −7 −8 Manual EM Automatic ... estimated θ using the following three methods: Manual: Let θ be the maximum likelihood estimate using manually transcribed data, i.e., D θasu = PKasu KD a asu Automatic: Let θ be the maximum...

Ngày tải lên: 20/02/2014, 09:20

4 471 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... Sentence Reptuentatton in Natural Language Inferenctng', to appear in IJCAI Proceedinqs 79 13 [KAMAN79] Kaplan, S J , "Cooperative Responses from a Portable Natural Larquage Data Base Query System', ... r Academia, Prague, ~ ~ [FIRBAS R6] Firhas, Jan, "On Defining the Theme in Functional Sentence Analysis", Travaux Lin~uistigues de Prague i, Univ of Alabama P r e s ~ [FIRBAS 74] Firbas,Jan, ... which flatten the tree The final stage of processing in the paraphraser is translation In the translation phase, labels In the parser's representation are translated into their corresponding words...

Ngày tải lên: 21/02/2014, 20:20

6 533 0
Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

... Binh, Nguyen Anh Tuan, Nguyen Huy Binh excitation Our new spectrometry system shows many advantages for studying Raman and Fluorescence spectra as well as weak optical signal spectra in general ... system we can now obtain weak optical signals, for example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed ... and may be set between and 30 Communications with the SR830 uses ASCII characters Commands may be in either upper or lower case and may contain any number of embedded space characters A command...

Ngày tải lên: 05/03/2014, 14:20

6 524 0
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

... resulting in an averaged spatially resolved concentration pattern for each wind class Various input data was taken into account in the calculations as described earlier [18,19], including annual data ... averages In addition, we examined mean maternal PM10 and NO2 exposure levels during total pregnancy according to maternal characteristics and infant characteristics Information on these characteristics ... home address, using a combination of continuous monitoring data and GIS based dispersion modelling techniques, taking into account both the spatial and temporal variation in air pollution In addition,...

Ngày tải lên: 06/03/2014, 19:20

11 514 0
Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt

Báo cáo khoa học: "Speakers’ Intention Prediction Using Statistics of Multi-level Features in a Schedule Management Domain" ppt

... (Goddeau, 1996), and a plan-based model (Litman, 1987) However, a finite-state model has a weak point that dialogue flows should be predefined Although a plan-based model can manage complex dialogue ... phenomena using plan inference, a plan-based model is not easy to be applied to the real world applications because it is difficult to maintain plan recipes In this paper, we propose a statistical ... dialogue, dialogue participants accomplish a given task by using shared domain knowledge Since a frame-based model is more 231 3.1 Evaluation Data sets and experimental settings We collected a...

Ngày tải lên: 17/03/2014, 02:20

4 307 0
Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

Accuracy of Clinical Signs in the Diagnosis of Pulmonary Tuberculosis: Comparison of Three Reference Standards Using Data from a Tertiary Care Centre in Rwanda doc

... sputa was performed All clinical and laboratory testing was part of routine examination For HIV testing, specific informed consent was asked and counseling offered Approval for this study was ... sputum examination Cavities were present in 34 and apical infiltrations in 73 patients There were no missing data on any of the tests or signs for the 300 patients Classical contingency table analysis ... haemoptysis and cavities have been found also in a study done in Burundi and Tanzania in 1997, also at a reference level, with culture as gold standard [14] Direct microscopy had a moderate, and...

Ngày tải lên: 22/03/2014, 18:20

7 506 0
Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

Báo cáo khoa học: Theoretical study of lipid biosynthesis in wild-type Escherichia coli and in a protoplast-type L-form using elementary flux mode analysis potx

... FabD, FabH_2, FabB_3, and AccACD In this cycle, acetyl-CoA is carboxylated (driven by ATP hydrolysis) and decarboxylated again (Fig 2) The remaining EFMs are capable of producing all of the main ... that E coli has a very complex metabolism An earlier metabolic pathway analysis of amino acid metabolism in E coli was also indicative of high redundancy [49] For analysis of robustness, rather ... knockouts, and comparison with in vivo viability data from the Keio collection Deficiency AccACD CdsA Cls FabA FabB FabD FabF FabG FabH FabI FabZ GpsA GutQ KdsA KdsB KdsC KdsD Lipid A Lipid A (ca) x...

Ngày tải lên: 22/03/2014, 21:20

12 554 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf

báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf

... Tsuchiya A, Williams A, Yfantopoulos J, De Charro F: A comparison of EQ-5D time trade-off values obtained in Germany, United Kingdom, Spain In The measurement and valuation of health status using ... and sociodemographic & clinical data and health status including age, gender, income, duration of diabetes, body mass index (an indicator of obesity), HbA1c level, number of diabetic complications, ... analyzing and collecting the data All authors have read and approved the final manuscript Acknowledgements This research was supported by a grant from Chulalongkorn University The authors thank diabetic...

Ngày tải lên: 18/06/2014, 19:20

9 498 1
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

báo cáo hóa học:" Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pdf

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

10 401 0
w