... Reference for Languages EFL English as a Foreign Language ESL English as a Second Language FLF Foreign Language Faculty HPU2 Hanoi Pedagogical UniversityNo2 ULIS University of Languages and International ... scope of Foreign Language Faculty, Hanoi Pedagogical University No Several papers and articles have investigated portfolios from the angle of an alternative assessment tool for traditional assessment ... toward clarity about where to aim and what standards to apply; assessment also prompts attention to where and how program goals will be taught and learned Clear, shared, implementable goals are the...
Ngày tải lên: 16/07/2015, 07:45
Using Linux As A Router
... kernel to act as a packet forwarder Slackware came with many excellent precompiled kernels, but IP forwarding was not an option Apparently, some random RFC specifies that IP forwarding is not to ... # make dep ; make clean # make zImage Then, before installing the kernel, in addition to backing up the current kernel, we also made a boot disk, just in case After putting a floppy in the A: ... you can rest easy knowing that the gated distribution has quite a few sample configuration files for you to copy Any router needs more than one interface to be useful, and our Linux router was...
Ngày tải lên: 18/10/2013, 17:15
... quickly transform carbohydrates to fat and fat to carbohydrates People can get just as fat eating carbs as they can eating fat In fact, unlike fat, carbohydrates stimulate your pancreas to secrete ... them mashed for dinner and fried for breakfast Her icebox was filled with eggs, meat, and dairy products at all times Her family could eat as much rich food as they wanted whenever they wanted Talk ... bound to eat more of another Indeed, Americans are now eating more carbohydrates—plant-based foods The biggest change in the American diet in the last thirty years has been a dramatic increase in...
Ngày tải lên: 15/02/2014, 15:20
Success as a real estate agent for DUMmIES
... change as drastically as it can in the residential arena ߜ You construct your own database Commercial real estate is a database business For example, in office leasing you have to create a database ... 24 hours a day, days a week The National Association of Realtors ran a huge marketing campaign a few years ago They circulated brochures, ran newspaper and magazine ads, and aired national TV commercials ... sought-after speakers in the real estate arena He has spoken to agents and managers at the local, regional, national, and international level for most of the large real estate brands, such as Coldwell...
Ngày tải lên: 27/03/2014, 01:27
Diaspora Bonds as a New Funding Vehicle for Developing Countries pdf
... e.g., Korean and Chinese diaspora in Japan; Indian and Pakistani diaspora in the United Kingdom; Turkish, Croatian and Serbian diasporas in Germany; Algerians and 11 National Jewish Population Survey ... facilitate—or constrain—the issuance of diaspora bonds include having a sizeable and wealthy diaspora abroad, and a strong and transparent legal system for contract enforcement at home Absence ... way of tapping into diaspora income flows on a regular basis,1 issuance of hard-currency-denominated bonds to the diaspora is a way of tapping into the latter’s wealth accumulated abroad Diaspora...
Ngày tải lên: 29/03/2014, 03:20
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications
... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, Design of plasmonic thin-film solar cells with broadband absorption ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... polycrystalline silicon film, with the goal of achieving broadband, polarization-insensitive absorption enhancement The antenna array is designed using bowtie apertures as basic elements In isolation,...
Ngày tải lên: 06/05/2014, 08:54
ridge aperture antenna array as a high efficiency coupler for photovoltaic applications
... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler R A Pala, J White, E Barnard, J Liu, and M L Brongersma, Design of plasmonic thin-film solar cells with broadband absorption ... Srigungsitthisunti, and Xu: Ridge aperture antenna array as a high efficiency coupler Fig Results for an aperture array defined by a = 750 nm (a) Reflection from aperture array in comparison to a bare silicon ... polycrystalline silicon film, with the goal of achieving broadband, polarization-insensitive absorption enhancement The antenna array is designed using bowtie apertures as basic elements In isolation,...
Ngày tải lên: 06/05/2014, 08:58
Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot
... environment Surface characterization Fourier transform infrared (FT-IR) spectra were obtained using a JASCO FT-IR 300E spectrometer (JASCO Inc., Easton, MD, USA) at a resolution of cm1 Dried samples ... observed that CSNPs had spherical morphologies with an average diameter of ca 4.5 nm Due to the small dimensions and high surface energy of the particles, it was easy for them to aggregate as seen ... (Figure 4a) and ICSNPs (Figure 4b) as measured by DLS The average size of CSNPs as determined by DLS was ca 21 nm On the other Figure XRD patterns of (a) mercaptoacetic acid-coated CSNPs and (b) bare...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article Using SVM as Back-End Classifier for Language Identification" ppt
... The back-end procedure takes discriminative language characterization scores from all available classifiers and maps them to final target language post probabilities Diagonal covariance Gaussian ... to assigning each of the observations into one of k classes As two-class problems are much easier to solve, many authors propose to use twoclass classifiers for multiclass classification PPPE algorithm ... values; thus, linear discriminant analysis (LDA) and diagonal covariance Gaussian models are used to calculate the log-likelihoods for each target language [24], and improvement has been achieved in...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: " “The non-ischemic repair” as a safe alternative method for repair of anterior post-infarction VSD" pptx
... operation is carried out using an off pump coronary artery bypass (OPCAB) stabilizer in order to perform the necessary distal coronary anastomoses and subsequently the proximal by partial clamping ... the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis is performed according to the standard ... Borger M, Rastan A, Mohr F: Beating heart coronary artery bypass in patients with acute myocardial infarction: a new strategy to protect the myocardium Myocardial Protection Futura Blackwell PublishingSalerno...
Ngày tải lên: 10/08/2014, 10:20
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot
... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... that all employees within the organization would be able to access and use spatial data and then produce maps The participant explained: 'I thought that's what this was for, was to build capacity...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " HIV as a chronic disease considerations for service planning in resource-poor settings" docx
... S, Akabayashi A, Kai I, Ohi G, Naka K: Correlation between history of contact with people living with HIV/AIDS (PWAs) and tolerant attitudes toward HIV/AIDS and PWAs in rural Thailand International ... first-line antiretroviral therapy in South Africa Antivir Ther 2008, 13(7):937-43 Colebunders R, Kamya MR, Laurence J, Kambugu A, Byakwaga H, Mwebaze PS, Muganga AM, Katwere M, Katabira E: First-line antiretroviral ... Grover A, Citro B: India: access to affordable drugs and the right to health The Lancet 2011 Ihucha A: Worry for AIDS patients ahead of EU-India deal The Citizen Tanzania; 2010 Access to Essential...
Ngày tải lên: 11/08/2014, 14:21
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps
... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... that all employees within the organization would be able to access and use spatial data and then produce maps The participant explained: 'I thought that's what this was for, was to build capacity...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo y học: " A Canadian naturalistic study of a communitybased cohort treated for bipolar disorder" pot
... company shares Page of 10 Ranjith Chandrasena: The author was an investigator in the study and was compensated for his participation Barry Jones: The author was employed by Eli Lilly Canada at the ... regimens as they felt appropriate and could add olanzapine to regimens of the Other cohort or add another SGA to regimens of the Olanzapine cohort A SGA and Table Mean change in YMRS, MADRS, BAI and ... statistical assistance and the medical writer Wendy Wilson (MASc) was funded by Eli Lilly Canada Inc., to prepare the manuscript Author details Lilly Research Laboratories, Eli Lilly Canada Inc,...
Ngày tải lên: 11/08/2014, 16:22
Báo cáo y học: "Bovine herpesvirus 4 based vector as a potential oncolytic-virus for treatment of glioma" pps
... below the pial surface Injection was carried out for 16 minutes and was performed using a Hamilton syringe Animals were monitored daily for neurological signs and weight loss At the appearance of ... type isolated from the spinal cord of a cow with astasia Archives of virology 2000, 145(11):2363-2370 Redaelli M, Cavaggioni A, Mucignat-Caretta C, Cavirani S, Caretta A, Donofrio G: Transduction ... English language correction and Italian Ministry of University and Scientific Research and the Fondazione Cariparma (Cassa di Risparmio di Parma, Italy) for funding contributions to the project Author...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "Synthetic rabbit-human antibody conjugate as a control in immunoassays for immunoglobulin M specific to hepatitis E virus" ppsx
... Golden A, Brashear J, Robinson J, Rapp M, Klass M, Ostrow DH, Mandecki W: Recombinant mouse-human chimeric antibodies as calibrators in immunoassays that measure antibodies to Toxoplasma gondii ... 34:983-999 13 Koshy A, Grover S, Hyams KC, Shabrawy MA, Pacsa A, al-Nakib B, Zaidi SA, al-Anezi AA, al-Mufti S, Burans J, Carl M, Richards AL: Short-term IgM and IgG antibody responses to hepatitis E virus ... immunosorbent assay (ELISA) using a HEV IgM Diagnostic Kit The results showed that the antibody conjugate was stable enough to be used in external quality assessment and internal quality control trials...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps
... Shirakawa I, Deichmann KA, Izuhara I, Mao I, Adra CN, Hopkin JM: Atopy and asthma: genetic variants of IL-4 and IL-13 signalling Immunol Today 2000, 21:60–64 105 Takabayashi A, Ihara K, Sasaki ... increased risk of asthma J Med Genet 1998, 35:463–467 131 Mao XQ, Shirakawa T, Kawai M, Enomoto T, Sasaki S, Dake Y, Kitano H, Hagihara A, Hopkin JM, Morimoto K: Association between asthma and an ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo y học: "Protein C as a surrogate end-point for clinical trials of sepsis" docx
... endpoints for chronic diseases Stat Med 1992, 11:167-178 Vasan RS: Biomarkers of cardiovascular disease: molecular basis and practical considerations Circulation 2006, 113: 2335-2362 Vangerow B, ... greater treatment benefit was observed The cohort was divided into groups with a higher and lower risk for death, based on the baseline biomarker cut-off levels The relative risk for death was ... Vincent JL, Bernard GR, Beale R, Doig C, Putensen C, Dhainaut JF, Artigas A, Fumagalli R, Macias W, Wright T, Wong K, Sundin DP, Turlo MA, Janes J: Drotrecogin alfa (activated) treatment in severe...
Ngày tải lên: 13/08/2014, 10:20
Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot
... (1386-5': GAAACTATGCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCTGTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously ... days Evaluation of the transduction rate DNA was extracted from macaque PBMCs and the amount used for each sample was normalized based on data for amplification of the β-globin gene, using 5'ACCATGGTGCTGTCTCCTGC-3' ... However, as the human-SCID mouse has a number of limitations as a model of AIDS, the efficacy and safety of this strategy should also be evaluated in a more appropriate model, such as macaques infected...
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "Martial arts as a mental health intervention for children? Evidence from the ECLS-K" doc
... participation in martial arts as opposed to stable participation over years Association of martial arts with change in behavior Tables and present the means and standard deviations for behavior at each ... Unweighted White, not Hispanic Black Hispanic, race specified Hispanic, race not specified Asian Hawaiian or Pacific Islander American Indian or Alaska native More than one race 66.8% 11.5% 7.5% 8.1% ... Statistics, using a strategy designed to ensure that weighted subsamples would be as nationally representative as possible These weights are numbers assigned to each case in the data set that are...
Ngày tải lên: 13/08/2014, 18:21