using a point reward system to motivate oneself

... Methods Animals All animal work was approved by the Institutional Animal Care and Use Committee (IACUC) of Integrated Laboratory Systems (ILS, Research Triangle Park, North Carolina, USA) or by ... The transducer was affixed to an offset cam to allow it to rotate in a horizontal plane against the bottom of the ultrasound chamber during treatment Ultrasound gel was used to coat the transducer ... breeders served as untreated controls Sham-treated animals underwent all preparations for ultrasound treatment as treated animals: anesthesia was administered and maintained at - 2.5% isoflurane/oxygen,...

Ngày tải lên: 05/03/2014, 17:20

... Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT ... GCATGTGCGTTCCAGGCTAGCA Forward CAAGGGACAAGGCTGCCCCG 109 bp NM_013693.2 tumor necrosis factor alpha Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT ... Sequence Amplicon Size Assession# Name b-Actin Forward GGCTGTATTCCCCTCCATC 141 bp NM_007393.2 actin, beta, cytoplasmic ASF Reverse ATGCCATGTTCAATGGGGTA Forward CAGATCGCCTACGCCATGCAGA 81 bp NM_008951.1...

Ngày tải lên: 19/06/2014, 22:20

... Namespaces, variables, and constants using System; using System. Configuration; using System. Windows.Forms; using System. Text; using System. IO; using System. Data; using System. Data.SqlClient; private ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns) ... System. EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load...

Ngày tải lên: 21/01/2014, 11:20

... cells SA has a potent anti-inflammatory effect mediated by suppression of the production of inflammatory mediators by inhibition of cyclooxygenase and nuclear factor-kappa B activation [9,10] In addition ... Ishihara, K., Yasuda, K & Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , ... 3465 Activation of HSF by SA and accumulation of Hsp10 5a and Hsp70 To examine whether SA enhances heat shock promoter activity by activating HSF, a gel mobility shift assay using 32 P-labelled...

Ngày tải lên: 17/03/2014, 10:20

... baseline and at discharge An occupational therapist blinded to patient allocation administered the CAHAI-7 and the CMSA at admission and discharge At discharge, participants completed two Likert Scales ... 34 Abdullah HA, Tarry C, Datta R, Mittal GS, Abderrahim M: A Dynamic Biomechanical Model to Assess and Monitor Robot-Assisted Therapy of Upper Limb Impairment” Journal of Rehabilitation Research ... Foundation of Ontario 2007 Mima T, Sadato N, Yazawa T, Fukuyama H, Yonekura Y, Shibasaki H: Brain structures related to active and passive finger movements in man Brain 1999, 4:105-110 Carel C, Loubinoux...

Ngày tải lên: 19/06/2014, 08:20

... rotation (45 years) and thinnings that are designed so as to maintain a constant and relatively low basal area after each cycle (15 m3 ha−1 ) The rotation of scenario is fixed to 60 years As for ... plain or transformed) to expand the information on explanatory variables A selection based on different aspects was considered: available variables, desirable variables with a high biological expression, ... the stand (in years), a, c, d and p are the fixed parameters of the model, and bi is a variable parameter related to the stand site index (dominant height reached at 50 years) specific to each site...

Ngày tải lên: 07/08/2014, 16:21

... PERMAPLUMB system can readily be integrated into procedures that require vertical shaft plumbness measurements Because the shaft will be rotated, it is necessary to take into account factors that ... thrust bearing data to make corrections on the thrust bearing, translation data to monitor the shaft position at the upper and lower guide bearings and tolerances to help determine when the shaft ... features a repeatability function to allow for previous measurements to be compared to the current measurements Repeatable measurements ensure that “what you see is what it really is.” Repeatability...

Ngày tải lên: 08/08/2014, 13:20

... Almeida E, Jordan B, Bauer P, Campos RA, Iapichino G, Edbrooke D, Capuzzo M, Le Gall JR; SAPS Investigators: SAPS – From evaluation of the patient to evaluation of the intensive care unit Part 2: Development ... of a prognostic model for hospital mortality at ICU admission Intensive Care Med 2005, 31:1345-1355 Zimmerman JE, Kramer AA, McNair DS, Malila FM: Acute Physiology and Chronic Health Evaluation ... ICU stay Competing interest The authors declare that they have no competing interests References Fernandez R, Baigorri F, Navarro G, Artigas A: A modified McCabe score for stratification of patients...

Ngày tải lên: 13/08/2014, 03:20

... VIETNAM NATIONAL UNIVERSITY-HANOI UNIVERSITY OF LANGUAGES AND INTERNATIONAL STUDIES FACULTY OF POST-GRADUATE STUDIES -    - TRẦN NGỌC GIANG A STUDY OF HOW TO MOTIVATE SECOND-YEAR ENGLISH MAJORS ... importance of motivation in language learning 1.1.4 Common factors affecting learners’ motivation in language learning 1.1.4.1 Learners’ factors 10 1.1.4.2 Parents’ factors ... 2.4 The data collection procedures 41 Chapter 3: Data analysis, Findings, and Discussions 42 3.1 Data analysis 42 3.1.1 Results from classroom observation and analysis ...

Ngày tải lên: 28/03/2015, 08:56

... course to set members at ease, to get them memorize each other‟s names, and to learn about each other; and warmers at the beginning of each class to allow members to readjust to the particular group ... learner‟s failure to understand the language they hear is an impetus, not an obstacle, to interaction and learning  Authentic spoken language presents a challenge for the learner to attempt to ... self-confident and likes it much Another factor is the learners‟ language learning strategies These can affect their mood to make them participate actively or passively in learning activities Learning strategies...

Ngày tải lên: 28/03/2015, 08:57

... say that language teachers can ask for assistance from content teachers Additionally, language teachers can choose a content subject that they are familiar with to instruct Do not try to teach ... implication is that the materials are similar to those used in native-language instruction; the other relates to the use of newspaper and magazine articles and any other media materials ―that were ... Hutchinson and Waters (1987) indicate that as well as having to cope with the uncertain values of the strange land of ESP, ESP teachers may also have to struggle to master language and subject matter...

Ngày tải lên: 30/03/2015, 14:31

... software named TOSMANA (Tool for Small-N Analysis , which allows to reduce the complexity of data sets by using Boolean algebra A To enable the csCQA work, an assessment grading tools was design to ... namely: The Controlled -to- Free Approach, The Free-Writing Approach, The Paragraph-Pattern Approach, The Grammar-Syntax-Organization Approach, The Communicative Approach, and The Process Approach ... writing to success are likely various among cases, but the cross-case factors are the use of a suitable text type, a correct format and a satisfactory length for cases and an appropriate text type and...

Ngày tải lên: 30/03/2015, 14:31

... and see what would happen Besides, Michael (1998) also points out that action research involves the collection and the analysis of data related to certain aspects of our professional practice In ... Different strategies to boost and maintain motivation in language learning and teaching are also included in this chapter o Chapter 2, Methodology, is devoted to describing elaborately the research methodology ... the author has to fulfill the tasks of teaching and doing research at the same time Clearly, carrying out action research to find out the answers to the problems emerging in classrooms can help...

Ngày tải lên: 10/08/2015, 19:47

Ngày tải lên: 27/08/2016, 21:00

... future applications, such as continuous learning of a user model while the dialog system is on-line, enabling automatic adaptation References −5 Truth Manual EM Automatic −6 −7 −8 Manual EM Automatic ... estimate using automatically transcribed data, i.e., θasu = e KD P as D e a Kas This approach ignores transcription errors and assumes that user behavior depends only on the observed data EM: ... which is the actual parameter θ used to generated the data The EM method has to estimate a larger number of parameters than the Automatic method (1344 vs 168) But as Figure shows, after observing...

Ngày tải lên: 20/02/2014, 09:20

Ngày tải lên: 15/03/2014, 23:20

... finish loading A button labelled “Reader” should appear in the address bar – just tap that button to enter the Reader Second is the Reading List It’s an easy way to put aside web pages to read later ... the Safari section of Preferences Once activated the Safari app changes from blue to black Finally, the iPad and iPad have finally gained tabbed browsing, allowing you to change between open pages ... messaging to all iOS devices Tweaks to Safari and the Camera and Photo apps Twitter integration, Newsstand, and the ability to cut the cord and use iOS devices without needing to sync them to a...

Ngày tải lên: 19/03/2014, 23:44

... not a replacement for, the clinical trial When is a Clinical Trial Appropriate? When is it appropriate to evaluate an NLG system with a large-scale task or effectiveness evaluation which compares ... cigarettes and ashtrays the day before When you stop, take one day at a time; don't look too far ahead If it gets tough Many people hit rough patches; there are ways to deal with these On the back page ... thanks to the rest of the STOP team, and especially to Ian McCann and Annette Hermse for their work in the clinical trial Thanks also to Yaji Sripada, Sandra Williams, and the anonymous reviewers for...

Ngày tải lên: 23/03/2014, 19:20

... language Other reason is because of motivation lack to practice the second language in daily conversation They are also too shy and afraid to take part in the conversation Many factors can cause ... taught in almost schools in Vietnam In respond to an appeal from social to improve the quality of education toward regional and international standards, language institutions are marking great ... language user, speaking is a chance to notice the gaps between what you want to say and what you can say, it is a chance to test hypotheses about language The terms “speaking” catches much attention...

Ngày tải lên: 07/06/2014, 16:13