... reasons for gathering and analyzing data, as well as the formulation of this data into use cases Use cases will be the foundation for determining data requirements for the system Module 3: Using ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information ... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather...
Ngày tải lên: 10/12/2013, 17:15
... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...
Ngày tải lên: 17/01/2014, 09:20
Báo cáo "Development of a software package for 3D structured mesh generation " pdf
... inverse mapping between the 3D real computational domain and a rectangular domain in the parametric space [1, 2, 5, 6] For short, the formulae for Y and Z coordinates are the same and they are not ... generation for the computational domain surrounding a 3D sinusoidal object Another 3D object is assumed to have a sinusoidal shape A 3D computational mesh will be generated for a specific domain ... interface of the package The package is designed with a main interface that allows users to input topographical elevation data of the top (upper) surface of any 3D objects in the form of digitized...
Ngày tải lên: 14/03/2014, 13:20
A BlueprinT for suCCess - A MAster PlAn for econoMic redeveloPMent pot
... Initiate Capital Campaign Recommendation EDC should engage and retain a professional capital campaign solicitor to a five-year campaign engaging both the public and private sectors Approach Interview ... Coalition of Southwest Indiana Organizational The asset-based analysis also made specific organizational recommendations regarding staffing, budget, governance and other related items that allow ... observed by the advantage, Southwest Indiana Southwest Indiana has achieved take the lead in proposing state success in many areas but it can be a legislation for a sustainable economic great region...
Ngày tải lên: 17/03/2014, 06:20
A Monthly Struggle for Self-Control? Hyperbolic Discounting, Mental Accounting, and the Fall in Consumption Between Paydays ppt
... reasonable parameter values, the model can generate a decline that matches the data We assume δ = 1, which is reasonable over a week or a day, and an annual interest rate of r = 0.03 In the case ... 47-68 Ariely, Dan and Klaus Wertenbroch (2002) “Procrastination, Deadlines, and Performance: Self -Control by Precommitment,” Psychological Science, May, 13, 219-224 Ashraf, Nava, Dean S Karlan, and ... University of California, Berkeley, Manuscript DellaVigna, Stefano and M Daniele Paserman (2005) “Job-Search and Impatience,” Journal of Labor Economics, July Fang, Hanming and Daniel Silverman (2004)...
Ngày tải lên: 23/03/2014, 03:20
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS: ... technical, programmatic, staffing and scale-up challenges that remain and demonstrate that although broad program principles of TB/HIV collaboration and integration are essential, specific program ... collaboration between HIV and TB programs and integrating services is underway The World Health Organization (WHO) has formulated recommendations regarding collaboration and integration and has...
Ngày tải lên: 20/06/2014, 08:20
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... SD2R1F TAGAATTCATCGCCACGACCATG SD2R1R TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay PD3 simX5D3R simEXX4F TAGAATTCGCGACAGGAGCCATA TAGAATTCGACGCCTTCCAGTC DNA-shift assay PX4 ... CCAATTGCGCTACGCTCCT DNA-shift assay PSEx1 PEx1R simA7F CCATGTAGGCGGTGACGA TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay PA7 simA7R ATAAGCTTGTCGATACCGATCTTC DNA-shift assay PEx2 DNA-shift assay PSR3 PEx2F ACTTCCCAGAAGTA ... TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay PR2Ex SR2ExXR TTTGAATTCTTGACCACCACTTC DNA-shift assay PSR2 PSR2F TCGACGAGGTCCTCTTTG PSR2R TCGTATTCATACACCGTAC PEx1F CCAATTGCGCTACGCTCCT...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo khoa học: " Investigation of tumor hypoxia using a twoenzyme system for in vitro generation of oxygen deficiency" pot
... angiogenesis.dkfz.de/oncoexpress/software/sumo/) was used for statistical analysis, two-class t-tests and GOanalysis Pathway analysis was performed based on information available on cellular signalling processes from a curated database ... microarray analysis was also performed for RNA isolated from cells incubated for the same time period (24 h) under normoxic conditions For bioinformatical-analysis a step-wise approach was applied: ... of vital cells after irradiation, compared to the non-irradiated control was calculated Statistical analysis Statistical analysis of the genomics was performed with SUMO (Christian Schwager,...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: " Using a summary measure for multiple quality indicators in primary care: the Summary QUality InDex (SQUID)" ppt
... practice performance reports (audit and feedback), optional semi-annual site visits to practices for academic detailing and participatory planning, and optional annual network meetings to share ... They appreciate its use for tracking a summary measure of quality over time, and are excited about its potential for appealing internally to their clinical and clerical staff, as well as externally ... [http://www.ama-assn.org/ama/upload/mm/370/ introperfmeasurement.pdf] Guidelines for the evaluation and management of heart failure Report of the American College of Cardiology/American Heart Association...
Ngày tải lên: 11/08/2014, 05:22
Báo cáo y học: "A comprehensive platform for quality control of botanical drugs (PhytomicsQC): a case study of Huangqin Tang (HQT) and PHY906" potx
... define and validate the quality control metric and to help set batch acceptance criteria Information-rich patterns are analyzed and compared with an established, well-characterized batch used for ... methods for both chemical and biological characterization While the traditional chemical analysis of standard marker compounds provides a useful quantitative mass balance, patterns of information-rich ... the National Cancer Institute (NCI) (CA-63477) of the National Institute of Health USA and the National Foundation for Cancer Research We also acknowledge that a small subset of the data and descriptions...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo y học: " Extension of Murray''''s law using a non-Newtonian model of blood flow" pptx
... the value of c from to has also been investigated [9] The in vivo wall shear stress in an arterial system has been measured [10] It was found that mean wall shear stress was far from constant along ... probably from in large arteries near the heart to in arterioles A method allowing for estimation of wall shear rate in arteries using the flow waveforms has been developed [11] This work allowed ... N, Niwa T, Fukasuwa H, Sasaki Y: Estimation of intravascular blood pressure gradient by mathematical analysis of arterial casts Tohoku J Exp Med 1963, 79:168-198 Sherman TF: On connecting large...
Ngày tải lên: 13/08/2014, 16:21
báo cáo hóa học: " Simulator sickness when performing gaze shifts within a wide field of view optic flow environment: preliminary evidence for using virtual reality in vestibular rehabilitation" pptx
... rotating their head Nausea was significantly greater when subjects navigated using their head The lag between head movement and scene movement, and the variability in frame update rate has also ... moving targets superimposed on both static and moving backgrounds was examined Eight different gaze tasks are performed on each visit (Table 1) Each gaze task was performed for 90 s with alternating ... is taken to minimize delays between head tracking devices and image updates, VR-induced retinal slip can be delivered in a controlled manner in order to cause adaptation A randomized trial has...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo y học: " Soluble receptor for advanced glycation end products in COPD: relationship with emphysema and chronic cor pulmonale: a case-control study" potx
... of RAGE lacking transmembrane and cytosolic domains, acts as a decoy receptor for RAGE ligands in the extracellular compartment, and is believed to afford protection against inflammation and ... statistical analysis was performed with Stata version 10 (StataCorp, College Station, TX) Results Sample characteristics The baseline characteristics of the study sample are summarized in table The control ... Buzzigoli E, Casolaro A, Natali A, Ferrannini E, Gastaldelli A: Circulating soluble receptor for advanced glycation end products is inversely associated with glycemic control and S10 0A1 2 protein...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: "Immediate determination of ACPA and rheumatoid factor - a novel point of care test for detection of anti-MCV antibodies and rheumatoid factor using a lateral-flow immunoassay" pdf
... device Lateral -flow immunochromatographic assay (LFIA) was manufactured as double antigen direct sandwich assay Devices (DCN, Carlsbad, CA, USA) for testing of up to 10 μl of biological samples ... http://arthritis-research.com/content/12/3/R120 Abbreviations ACPA: autoantibodies against citrullinated protein/peptide antigens; anti-MCV: autoantibodies against mutated and citrullinated vimentin; anti-CCP: autoantibodies against ... Specificity was calculated against rheumatic diseases and a healthy control group In this study, prevalence was considered as the ratio of seropositive RA patients against all patients with rheumatic...
Ngày tải lên: 12/08/2014, 14:22
A study of advanced control charts for complex time between events data
... Chapter EWMA chart for transformed Weibull data Chapter Two MEWMA charts for GBE data Chapter Design of the MEWMA chart for raw GBE data Chapter Design of the MEWMA chart for transformed GBE data ... provide any general design guidelines Chapter A Study on EWMA TBE Chart on Transformed Weibull Data 3.1 Transform the Weibull data into Normal data using Box-Cox transformation Many transformation ... mean and covariance matrix of the multivariate normal distribution 22 Chapter A Study on EWMA TBE Chart on Transformed Weibull Data CHAPTER A STUDY ON EWMA TBE CHART ON TRANSFORMED WEIBULL DATA...
Ngày tải lên: 09/09/2015, 18:58
A study of new and advanced control charts for two categories of time related processes
... mean and range normalization Baxter (1995) applied and studied standardization and transformation in 23 principal component analysis Normalization techniques for microarray data are studied and ... shifts and the covariance matrix shifts Transformation is applied when acceptable seasonality occurs We analyze the effect of standardization and compare it to an alternative approach -a sequential ... Standardized Data xiv Fig 6.1 FMEWMA Chart for the Initial State Raw GBE Data Fig 6.2 FMEWMA Chart for the Initial State Transformed GBE Data Fig 6.3 MEWMA chart with r = 0.1 for the Initial State Raw GBE...
Ngày tải lên: 10/09/2015, 09:11
Vector sum phase shifter using a quadrature magic t for application in polarization control
... a linearly polarized horn antenna, Fig 1-2 shows a dual linear polarization horn antenna, Fig 1-3 shows a circularly polarized spiral antenna, and Fig 1-4 shows a dual linearly polarized array, ... polarization spiral antenna Fig 1-4: Dual linear polarization array taken from [7] It is important to note that the dual linear polarization antenna can also be converted into a circular polarized ... communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna polarization is a characteristic of the antenna and...
Ngày tải lên: 30/09/2015, 10:11
A study on improving quality control on vietnamese lacquerware for the u s market using swot analysic
Ngày tải lên: 09/11/2015, 09:01
AN1292 sensorless field oriented control (FOC) for a permanent magnet synchronous motor (PMSM) using a PLL estimator and field weakening (FW)
... SHALL NOT, IN ANY CIRCUMSTANCES, BE LIABLE FOR SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES, FOR ANY REASON WHATSOEVER All of the software covered in this application note is available as a single ... certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality ... 949-462-9608 Santa Clara Santa Clara, CA Tel: 408-961-6444 Fax: 408-961-6445 Toronto Mississauga, Ontario, Canada Tel: 905-673-0699 Fax: 905-673-6509 Australia - Sydney Tel: 61-2-9868-6733 Fax: 61-2-9868-6755...
Ngày tải lên: 11/01/2016, 17:05