using a combination of methods for bioremediation
Enzymes in the Environment: Activity, Ecology and Applications - Chapter 21 (end) pps
Ngày tải lên :
11/08/2014, 15:20
... substrates have been used for the assay of β-glucosidase, phosphatase, and arylsulfatase activities in peat (87) and for assay of β-cellobiase, βgalactosaminemidase, β-glucosidase, and β-xylosidase, ... α-Gal, α-galactosidase; β-Gal, β-galactosidase, α-Glu, α-glucosidase; β-Glu, β-glucosidase c l-Asg: l-asparaginase; l-Glu, l-glutaminase; Amid, amidase; urea, urease; l-Asp, l-aspartase d Acid-P, ... of β-d-glucosidase, β-d-galactosidase, N-acetyl-β-dglucosaminidase, β-cellobiase, β-xylosidase, acid phosphatase, and arylsulfatase in a sandy loam and a silty clay loan soil Marx and coworkers...
- 30
- 443
- 0
báo cáo hóa học: " Effect of substrate (ZnO) morphology on enzyme immobilization and its catalytic activity" pptx
Ngày tải lên :
21/06/2014, 02:20
... of TEOS to APTES was 1:1, a coating layer of approximately nm can be generated on the surface of ZnO nanocrystal, but, at the same time, lots of isolated SiO nanocrystals were formed, as shown ... Electron, USA), and Zeta potentials obtained on Nicomp 380/ZLS (America) Surface functionalization of ZnO nanocrystals A typical surface functionalization process was as follows In general, 100 mg of ... 2060204), and China postdoctoral science foundation (No 20100470131) Author details National Key Laboratory of Micro/Nano Fabrication Technology, Key Laboratory for Thin Film and Microfabrication of...
- 7
- 419
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the cambialistic superoxide dismutase from Aeropyrum pernix K1 – insights into the enzyme mechanism and stability pdf
Ngày tải lên :
14/02/2014, 22:20
... Academia Sinica and National Synchrotron Radiation Research Center (Taiwan, ROC) We thank Ms M.Sakai (Osaka University) for performing ultracentrifugation analysis and Mr K Mieda and M Sakata ... hyperthermophilic archaeon growing at temperatures up to 100°C Int J Syst Bacteriol 46, 1070–1077 10 Kawarabayasi Y, Hino Y, Horikawa H, Yamazaki S, Haikawa Y, Jin-no K, Takahashi M, Sekine M, Baba S, Ankai A ... calculated using a randomly-selected 5% of the dataset that was omitted from all stages of refinement eRamachandran plots were prepared for all residues other than Gly and Pro a 600 FEBS Journal...
- 12
- 762
- 0
Tài liệu Báo cáo khoa học: Structural insights into the substrate specificity and activity of ervatamins, the papain-like cysteine proteases from a tropical plant, Ervatamia coronaria ppt
Ngày tải lên :
18/02/2014, 16:20
... map of ervatamin -A at various levels clearly indicates that Cys114 and Cys193 adopt rotamer conformations that are unfavorable for the formation of a disulfide bond, and remain in a reduced form ... Chakraborty S, Biswas S, Chakrabarti C & Dattagupta JK (2005) Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria Acta Crystallogr ... residues of the substrates are in bold Ervatamin -A Substrates N-benzoyl-Phe-Val-Arg-pNA D-Val-Leu-Lys-pNA D-Ile-Phe-Lys-pNA Ala-Ala-Val-Ala-pNA D-Ile-Pro-Arg-pNA Na-benzoyl-Arg-pNA D-Leu-Ser-Thr-Arg-pNA...
- 14
- 634
- 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
Ngày tải lên :
19/02/2014, 07:20
... cleavage of 23S.5DGb pre-RNA, and quantication %Preịt ẳ A expka tị ỵ B expkb tị A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same ... exon, and 25 bp of the 3Â exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 117), a six-nucleotide transcription ... divalent and monovalent salts as the only aids to RNA folding, however, the formation of alternative, nonproductive base pairs can trap a fraction of a large ribozyme in inactive conformations [1618]...
- 14
- 480
- 0
Báo cáo khoa học: The ‘pair of sugar tongs’ site on the non-catalytic domain C of barley a-amylase participates in substrate binding and activity potx
Ngày tải lên :
23/03/2014, 07:20
... Mutant cDNA was amplied using 5Â-TTTGAATTCCATGGGGAAGAACG GCAGC-3Â as sense orientation primer and a puried megaprimer Pfu DNA polymerase (Stratagene, La Jolla, CA) was used for PCR and products ... available online: Table S1 Crystal data, data collection, and renement statistics for sugar tongs AMY1 mutants in complex with acarbose This material is available as part of the online article from ... Numerous attempts at collecting data of improved quality for AMY1 Y38 0A acarbose failed and from the obtained structure it cannot be excluded that trace amounts of carbohydrate occupy the active...
- 13
- 385
- 0
Báo cáo khoa học: Structure and activity of the atypical serine kinase Rio1 doc
Ngày tải lên :
30/03/2014, 20:20
... presence of ATP and manganese demonstrated partial hydrolysis of ATP, consistent with data that indicate much higher autophosphorylation activity of Rio1 than Rio2 We have also shown that Rio1 is active ... side chain aromatic ring located ˚ very near Ala61 (3.91 A between the alanine Cb and the nearest aromatic carbon) in the presence of ATP or ADP (Fig 4A, B) As such, a longer polar side chain would ... suggests a requirement for additional conformational changes or activation The c-phosphate is located closer to the ˚ catalytic aspartate residue in Rio1 (5.1 A) than in ˚ ) We have observed a dramatic...
- 16
- 315
- 0
báo cáo khoa học: "Deficiency of maize starch-branching enzyme i results in altered starch fine structure, decreased digestibility and reduced coleoptile growth during germination" pot
Ngày tải lên :
11/08/2014, 11:20
... was quantified at Day 1, 6, 8, 11, and percentage of starch content at each day against the dry weight of Day kernels was plotted1 1Each data point is mean ± standard error of measurements of ... porcine pancreatic a- amylase and amyloglucosidase (enzymes from RS Assay Kit, Cat.No K-RSTAR, Megazyme), the sample tube was removed from the water bath and to an aliquot of each sample was added ... for analysis Using the combined data, values for five parameters in the equation were determined for each biological replication A mean and standard deviation of the five parameters for each...
- 13
- 176
- 0
Báo cáo khoa học: " Influence of the RNase H domain of retroviral reverse transcriptases on the metal specificity and substrate selection of their polymerase domains" potx
Ngày tải lên :
12/08/2014, 04:20
... of ribonuclease H phased at A resolution by MAD analysis of the selenomethionyl protein Science 1990, 249:1398-1405 Katayanagi K, Miyagawa M, Matsushima M, Ishikawa M, Kanaya S, Ikehara M, Matsuzaki ... PCR-amplified using the upstream primer (5'-CCC AGA CGC CGA CAC CTG GTA GGT AGA TGG GGC AGC TAA CAG G-3'), and the downstream primer (5'-TAT AGG GAC CCT CGA GTA GTA CTT TCC TGA TTC CAG C3'), and pKKRT66 as ... bp was PCR-amplified using the upstream primer (5' TAT GGG GCC ATA TGA ATA TAG AAG ATG AG 3') and the downstream primer (5' TGG CGA GCT CTA CGT ACC AGG TGG GGT CGG CGT 3'), and pET28aMRT as a template...
- 11
- 259
- 0
Computational methods for structure activity relationship analysis and activity prediction
Ngày tải lên :
26/11/2015, 09:53
... data sets are indispensable Activity Landscapes The descriptive approaches for SAR analysis include various data mining and visualization methods to systematically analyze SARs on a large-scale ... information Characteristic SAR patterns that emerge from the graph are easily identified The molecular hierarchy enables “forward−backward” analysis of compound data and reveals both global and ... SARs The activity landscape concept is an approach that has become popular.4,30 An activity landscape can be defined as any graphical representation that integrates similarity and potency relationships...
- 146
- 343
- 0
Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH
Ngày tải lên :
05/09/2013, 09:38
... PAOmix probe (a mixture of CCGTCATCTACWCAGGGTATTAAC, CCCTCTGCCAAACTCCAG, and GTTAGCTACGGCACTAAAAGG) (Crocetti et al., 2000) targeting at Candidatus ‘Accumulibacter phosphatis’, one of the PAOs; ... uptake was evaluated Furthermore, MAR-FIRH was applied to clarify the impact of pH on carbon uptake by PAOs and GAOs MATERIALS AND METHODS Labeled acetate Tritium labeled sodium acetate, 150μCi ... Chemical analyses Acetate and phosphate ions were determined by ion chromatography using a Compact IC 761 (Metrohm, Switzerland) or DX-AQ1110 (Dionex, USA) ion chromatograph MAR and MAR-FISH Analyses...
- 9
- 457
- 0
Tài liệu Gravitational Physics: Exploring the Structure of Space and Time pdf
Ngày tải lên :
12/02/2014, 16:20
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... development of the space-based electromagnetic observational capabilities that have already revealed a rich range of astronomical phenomena • Use astronomical observations of supernovae and gravitational ... COMMITTEE ON GRAVITATIONAL PHYSICS JAMES B HARTLE, University of California at Santa Barbara, Chair ERIC G ADELBERGER, University of Washington ABHAY V ASHTEKAR, Pennsylvania State University...
- 129
- 573
- 0
Tài liệu FLUID-STRUCTURE INTERACTIONSSLENDER STRUCTURES AND AXIAL FLOW VOLUME 1 ppt
Ngày tải lên :
13/02/2014, 16:20
... N.S Namachchivaya of the University of Illinois, S Hayama and S Kaneko of the University of Tokyo, Y Sugiyama of Osaka Prefecture, M Yoshizawa of Keio, the late Y.Nakamura of Kyushu and many others, ... (1960)l After separation of variables, with separation constant A the spatial equation admits a solution : , consiting of exponentials of &A, and &A, .i Substitution into (2.23) gives a system of four ... Generally, and A are linear differential operators, although A in many cases is a scalar, and A( = Q2) is the eigenvalue In the case of equation (2.30), = EI (a4 /8x4) and A = m M,S(x - L ) The equivalent...
- 598
- 404
- 2
Tài liệu Child mental health and educational attainment: multiple observers and the measurement error problem ppt
Ngày tải lên :
18/02/2014, 15:20
... between early mental health and later outcomes Few data sources are available that give both screening and diagnostic-type information for large representative samples Whatever type of information ... educational age and actual age A similar model with the dependent variable re-expressed as a proportion of actual age gave similar results but a considerably worse sample fit and those results are ... is a vector of variables, available to all observers, reflecting causal factors including the child’s personal characteristics, family and social circumstances and the occurrence of past traumatic...
- 37
- 387
- 0
Tài liệu Báo cáo khoa học: Applications of diagonal chromatography for proteomewide characterization of protein modifications and activity-based analyses doc
Ngày tải lên :
18/02/2014, 16:20
... sorting apparatus itself The latter is, in principle, an automated HPLC apparatus equipped with an autosampler, and can be purchased from a variety of companies; and, at least in our hands, HPLC ... their analyses using isobaric tags for relative and absolute quantification (iTRAQ) reagents for the identification of matrix metalloproteinase-2 substrates in fibroblasts [45] Clearly, both gel-based ... overall majority of the identified cleavage sites were uncharacterized An analogous setup was used for an in vitro analysis of the substrates of the HrtA2 ⁄ Omi protease [36] In that FEBS Journal...
- 13
- 578
- 0
Social Audit: A Toolkit A Guide for Performance Improvement and Outcome Measurement doc
Ngày tải lên :
06/03/2014, 23:20
... administration and Gram Panchayat members, particularly Panchayat Secretary and the Sarpanch and update them about the plan of conducting an audit The Social Auditor should also use relevant secondary ... performance of the organisation; • To provide a basis for shaping management strategy in a socially responsible and accountable way and to design strategies; • To facilitate organisational learning ... towards recording, rmance against standards, processing, summarising examining and analysing and reporting of financial deviations, taking corrective data actions and reappraising standards based...
- 101
- 442
- 1
Báo cáo khoa học: Kinetics of enzyme acylation and deacylation in the penicillin acylase-catalyzed synthesis of b-lactam antibiotics pptx
Ngày tải lên :
08/03/2014, 08:20
... similar constants for the Vs/Vh for deacylation with 7-ADCA and 6-APA using PAA and PGA However they observed in all cases a saturation of the (Vs/Vh)max, whereas our data indicate a linear relation ... instead of 6-APA and phenylglycine amide as the acyl donor, a higher Vs/Vh was observed at all concentrations of 7-ADCA The dependence of Vs/Vh on [7-ADCA] was linear, with a value of 0.33 mM)1 for ... relation for the combinations of 7-ADCA/PGA and 6-APA/PAA Since their measurements were carried out at a different pH, this indicates that competition between water and the nucleophilic b-lactam at...
- 9
- 518
- 1
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx
Ngày tải lên :
08/03/2014, 08:20
... CELLQUEST software program (Becton Dickinson and Co.) was used to acquire and analyze data A minimum of at least 10 000 cells was analyzed Computation of specific constitutive activity (SCA) and relative ... relative SCA (RSCA) Given that the transfection efficiency for each construct is constant for a given batch of cells, the SCA was calculated by: SCA ¼ ðAr À AvÞ=ðFr À FvÞ where Ar and Av are the cAMP ... EIA, using a monoclonal antibody directed against the extracellular domain of the TSH receptor (NCL-TSH-R2, Novocastra Laboratories Ltd, Newcastle, UK) (data not shown), and by FACS analysis using...
- 9
- 499
- 0
Gravitational Physics Exploring the Structure of Space and Time docx
Ngày tải lên :
14/03/2014, 10:20
... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... development of the space-based electromagnetic observational capabilities that have already revealed a rich range of astronomical phenomena • Use astronomical observations of supernovae and gravitational ... COMMITTEE ON GRAVITATIONAL PHYSICS JAMES B HARTLE, University of California at Santa Barbara, Chair ERIC G ADELBERGER, University of Washington ABHAY V ASHTEKAR, Pennsylvania State University...
- 128
- 480
- 0