using a combination of methods for bioremediation

... PRA Participatory Rural Appraisal RMA Rapid Market Appraisal RRA Rapid Rural Appraisal SCP Structure, Conduct, Performance model SIFFS South Indian Federation of Fishermen Societies SLA Sustainable ... India and Bangladesh as case studies It is primarily aimed at researchers and A Guide to the Analysis of Fish Marketing Systems Using a Combination of Sub-sector Analysis and the Sustainable ... chain, for example, are fishers and/or villagers aware of prices in the main fish markets (i.e the regional or national markets, i.e Dhaka, Chittagong, Cox’s Bazaar and Khulna)? G Are there barriers...

Ngày tải lên: 07/03/2014, 00:20

... surface of articular cartilage after trauma or transplantation. The objective of this study was to investigate the initiation of immediate bonding of articular cartilage blocks by means of combining ... transglutaminase (Ajinomoto Foods, Hamburg, Ger- many) at a final concentration of 60 U per gram dry weight of cartilage block in 0.01 M acetic acid, adjusted to pH 6 (trans- glutaminase was applied ... effects of the surface degradation treatment, the extracellular matrix content of cartilage blocks was analysed after being subjected to the respective agents. Additionally, the supernatant was analysed...

Ngày tải lên: 09/08/2014, 10:20

... Periodicals, Inc WIREs Climate Change Characterizing half -a- degree difference TABLE | Summary of Advantages and Disadvantages of each of the Four Methodologies Advantages A Scenario Approach Disadvantages ... spatial patterns which are linearly scaled to each degree of warming Pattern scaling may have advantages in its ability to isolate the global warming signal from some forms of natural variability, ... climate system (which is partly captured by using an ensemble of different models), and natural variability (both interannual stochastic variability and multi-decadal modes of natural variability)...

Ngày tải lên: 24/11/2022, 17:46

... measurements allowing all data to be taken in a label-free manner In this paper we investigate a multi-modal all-optical label-free approach for the identification of immune cells In particular we focus ... RS has thus been a prime candidate for use along-side complimentary optical techniques In particular an advantage would be gained by combining RS with a morphological approach such as optical ... guidance10 Shape and optical thickness are also useful parameters, particularly for the discrimination between cells, and may be recorded via quantitative phase imaging Digital holographic microscopy...

Ngày tải lên: 04/12/2022, 15:38

... [9]…………………………… 22 Table Anaerobic degradability of pulp and paper mill wastewater[19]… … 23 Table Data of standard curve 30 Table Data of ammonia standard curve……………………………………….32 Table Data of nitrite ... Sequential (anaerobic/aerobic) biological treatment of Dalaman SEKA Pulp and Paper Industry effluent, Waste Management 21 717–724 [27] Jukka A. Rintala & Jaakko A Puhakka(1994),Anaerobic treatment ... Chemical Engineering Journal 137, 510–517 [18] Angela Claudia Rodrigues, Marcela Boroski, Natalia Sueme Shimada, juliana Carla Garcia, Jorge Nozaki, Noboru Hioka (2007),Treatment of pulp and paper...

Ngày tải lên: 25/09/2020, 15:32

... 22 Table Anaerobic degradability of pulp and paper mill wastewater[19]… .23 Table Data of standard curve 30 Table Data of ammonia standard curve 32 Table Data of nitrite standard ... Sequential (anaerobic/aerobic) biological treatment of Dalaman SEKA Pulp and Paper Industry effluent, Waste Management 21 717–724 [27] Jukka A. Rintala & Jaakko A Puhakka(1994),Anaerobic treatment ... Journal 137, 510–517 [18] Angela Claudia Rodrigues, Marcela Boroski, Natalia Sueme Shimada, juliana Carla Garcia, Jorge Nozaki, Noboru Hioka (2007),Treatment of pulp and paper mill wastewater...

Ngày tải lên: 23/12/2021, 21:32

... Sequential (anaerobic/aerobic) biological treatment of Dalaman SEKA Pulp and Paper Industry effluent, Waste Management 21 717–724 [27] Jukka A. Rintala & Jaakko A Puhakka(1994),Anaerobic treatment ... Table Data of standard curve 30 Table Data of ammonia standard curve……………………………………….32 Table Data of nitrite standard curve making………………………………… 33 Table Data of nitrate standard curve……………………………………… ... wastewater, Chemical Engineering Journal 137, 510–517 [18] Angela Claudia Rodrigues, Marcela Boroski, Natalia Sueme Shimada, juliana Carla Garcia, Jorge Nozaki, Noboru Hioka (2007),Treatment of...

Ngày tải lên: 13/07/2022, 16:09

... point of view, a PF algorithm performs a data fusion process that consists of approximating the a posteriori distribution of the target and sensor trajectories, as well as any estimators that can ... problem of tracking a maneuvering target using dynamic binary sensors is formally stated in Section and a system model suitable for application of the PF methods is derived Four target-tracking PF algorithms ... where νx , νs > are adjustable parameters that control the variance of the propagation process, and zx,t , zs,t are complex Gaussian vectors with zero mean and covariance matrices I2 and INs , respectively...

Ngày tải lên: 22/06/2014, 23:20

... Table Average (standard error) change of accuracy of MEBV for individuals in the evaluation population as affected by alternative simulation situations Method unequal QTL variance equal QTL variance ... larger than variance of remaining QTL (unequal QTL variance) or equal for all QTL (equal QTL variance) Methods BM, LARS and PLSR were used to calculate the MEBV The averages and standard deviations ... QTL variance) or equal for all QTL (equal QTL variance) The averages and standard deviations were calculated using 60 replicated simulations equal QTL variance The variance of MEBV calculated with...

Ngày tải lên: 14/08/2014, 13:21

... substrates have been used for the assay of β-glucosidase, phosphatase, and arylsulfatase activities in peat (87) and for assay of β-cellobiase, βgalactosaminemidase, β-glucosidase, and β-xylosidase, ... α-Gal, α-galactosidase; β-Gal, β-galactosidase, α-Glu, α-glucosidase; β-Glu, β-glucosidase c l-Asg: l-asparaginase; l-Glu, l-glutaminase; Amid, amidase; urea, urease; l-Asp, l-aspartase d Acid-P, ... of β-d-glucosidase, β-d-galactosidase, N-acetyl-β-dglucosaminidase, β-cellobiase, β-xylosidase, acid phosphatase, and arylsulfatase in a sandy loam and a silty clay loan soil Marx and coworkers...

Ngày tải lên: 11/08/2014, 15:20

... Academia Sinica and National Synchrotron Radiation Research Center (Taiwan, ROC) We thank Ms M.Sakai (Osaka University) for performing ultracentrifugation analysis and Mr K Mieda and M Sakata ... hyperthermophilic archaeon growing at temperatures up to 100°C Int J Syst Bacteriol 46, 1070–1077 10 Kawarabayasi Y, Hino Y, Horikawa H, Yamazaki S, Haikawa Y, Jin-no K, Takahashi M, Sekine M, Baba S, Ankai A ... calculated using a randomly-selected 5% of the dataset that was omitted from all stages of refinement eRamachandran plots were prepared for all residues other than Gly and Pro a 600 FEBS Journal...

Ngày tải lên: 14/02/2014, 22:20

... map of ervatamin -A at various levels clearly indicates that Cys114 and Cys193 adopt rotamer conformations that are unfavorable for the formation of a disulfide bond, and remain in a reduced form ... Chakraborty S, Biswas S, Chakrabarti C & Dattagupta JK (2005) Crystallization and preliminary X-ray diffraction studies of the cysteine protease ervatamin A from Ervatamia coronaria Acta Crystallogr ... residues of the substrates are in bold Ervatamin -A Substrates N-benzoyl-Phe-Val-Arg-pNA D-Val-Leu-Lys-pNA D-Ile-Phe-Lys-pNA Ala-Ala-Val-Ala-pNA D-Ile-Pro-Arg-pNA Na-benzoyl-Arg-pNA D-Leu-Ser-Thr-Arg-pNA...

Ngày tải lên: 18/02/2014, 16:20

... cleavage of 23S.5DGb pre-RNA, and quantication %Preịt ẳ A expka tị ỵ B expkb tị A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same ... exon, and 25 bp of the 3Â exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 117), a six-nucleotide transcription ... divalent and monovalent salts as the only aids to RNA folding, however, the formation of alternative, nonproductive base pairs can trap a fraction of a large ribozyme in inactive conformations [1618]...

Ngày tải lên: 19/02/2014, 07:20

... Mutant cDNA was amplied using 5Â-TTTGAATTCCATGGGGAAGAACG GCAGC-3Â as sense orientation primer and a puried megaprimer Pfu DNA polymerase (Stratagene, La Jolla, CA) was used for PCR and products ... available online: Table S1 Crystal data, data collection, and renement statistics for sugar tongs AMY1 mutants in complex with acarbose This material is available as part of the online article from ... Numerous attempts at collecting data of improved quality for AMY1 Y38 0A acarbose failed and from the obtained structure it cannot be excluded that trace amounts of carbohydrate occupy the active...

Ngày tải lên: 23/03/2014, 07:20

... presence of ATP and manganese demonstrated partial hydrolysis of ATP, consistent with data that indicate much higher autophosphorylation activity of Rio1 than Rio2 We have also shown that Rio1 is active ... side chain aromatic ring located ˚ very near Ala61 (3.91 A between the alanine Cb and the nearest aromatic carbon) in the presence of ATP or ADP (Fig 4A, B) As such, a longer polar side chain would ... suggests a requirement for additional conformational changes or activation The c-phosphate is located closer to the ˚ catalytic aspartate residue in Rio1 (5.1 A) than in ˚ ) We have observed a dramatic...

Ngày tải lên: 30/03/2014, 20:20

... was quantified at Day 1, 6, 8, 11, and percentage of starch content at each day against the dry weight of Day kernels was plotted1 1Each data point is mean ± standard error of measurements of ... porcine pancreatic a- amylase and amyloglucosidase (enzymes from RS Assay Kit, Cat.No K-RSTAR, Megazyme), the sample tube was removed from the water bath and to an aliquot of each sample was added ... for analysis Using the combined data, values for five parameters in the equation were determined for each biological replication A mean and standard deviation of the five parameters for each...

Ngày tải lên: 11/08/2014, 11:20

... of ribonuclease H phased at A resolution by MAD analysis of the selenomethionyl protein Science 1990, 249:1398-1405 Katayanagi K, Miyagawa M, Matsushima M, Ishikawa M, Kanaya S, Ikehara M, Matsuzaki ... PCR-amplified using the upstream primer (5'-CCC AGA CGC CGA CAC CTG GTA GGT AGA TGG GGC AGC TAA CAG G-3'), and the downstream primer (5'-TAT AGG GAC CCT CGA GTA GTA CTT TCC TGA TTC CAG C3'), and pKKRT66 as ... bp was PCR-amplified using the upstream primer (5' TAT GGG GCC ATA TGA ATA TAG AAG ATG AG 3') and the downstream primer (5' TGG CGA GCT CTA CGT ACC AGG TGG GGT CGG CGT 3'), and pET28aMRT as a template...

Ngày tải lên: 12/08/2014, 04:20

... data sets are indispensable Activity Landscapes The descriptive approaches for SAR analysis include various data mining and visualization methods to systematically analyze SARs on a large-scale ... information Characteristic SAR patterns that emerge from the graph are easily identified The molecular hierarchy enables “forward−backward” analysis of compound data and reveals both global and ... SARs The activity landscape concept is an approach that has become popular.4,30 An activity landscape can be defined as any graphical representation that integrates similarity and potency relationships...

Ngày tải lên: 26/11/2015, 09:53

... president of the National Academy of Sciences The National Academy of Engineering was established in 1964, under the charter of the National Academy of Sciences, as a parallel organization of outstanding ... development of the space-based electromagnetic observational capabilities that have already revealed a rich range of astronomical phenomena • Use astronomical observations of supernovae and gravitational ... COMMITTEE ON GRAVITATIONAL PHYSICS JAMES B HARTLE, University of California at Santa Barbara, Chair ERIC G ADELBERGER, University of Washington ABHAY V ASHTEKAR, Pennsylvania State University...

Ngày tải lên: 12/02/2014, 16:20