user interface a software module or program through which users

... languages such as C++, Java and Visual Basic, and even in machine code or assembly language Any high-level programming language that supports arrays may be used to develop graphics transformation ... used for creating ActiveX controls that may also be created using the: • C++ programming language • Java programming language • Visual Basic programming language (See Active X Control, Java, and ... associated with mainframe computers are seen as a key disadvantage (See Client/server.) Application software A program or suite of programs designed to perform a particular task, or set of tasks...

Ngày tải lên: 29/05/2014, 15:31

... underlying database of movie information is stored in XML format When a new database is available, a Grammar Compiler component extracts and normalizes the relevant fields from the database These are ... control is more familiar to users and allows for a more relaxed interaction since they can lean back on the couch Also many users are concerned about the quality of their handwriting and may avoid ... the evaluation Prior studies have primarily conducted qualitative evaluation with small groups of users (5 or 6) A quantitative and qualitative evaluation was conducted examining the interaction...

Ngày tải lên: 20/02/2014, 12:20

... interface is particularly applicable in a mobile context, in which text entry is slow and circumstances may prohibit speech altogether We fitted a 3-gram language model to the same corpus as above ... and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence filtering In Proc ARPA Human Lang Tech Workshop, Plainsboro, NJ, mar E Schofield and G Kubin 2002 On interfaces for mobile ... too slow in a spoken interface or on a mobile device after factoring in the additional computational overhead of decoding the speech and the longer latency in mobile data networks We have now implemented...

Ngày tải lên: 08/03/2014, 04:22

... Figure 1: Architecture This architecture forms an ideal platform for the implementation of the phonological interface Necessary adaptions are limited to the data used: An existing grammar was extended ... grammatical representation via feature-filters There are few theoretical frameworks in computational linguistics for tackling such a breadth of phonological issues Linguistically ambitious approaches ... sequence paradigm The handling of accentuation and phrmsing by the generator resembles the syntacto-semantic approaches Only a few tags such as emphasis [EMPH] and (conceptual or textual) givenness...

Ngày tải lên: 08/03/2014, 06:20

... e ı a Measures for Automatic Machine Translation Evaluation Machine Translation, 24(3–4):77–86 Ahmed El Kholy and Nizar Habash 2011 Automatic Error Analysis for Morphologically Rich Languages ... that arise during Spanish-Catalan translation at several levels: orthographic, morphological, lexical, semantic and syntactic errors Works towards the automatic identification and classification ... Error Analysis and Proposed Solutions for the Catalan—Spanish Language Pair LREC, 45(2):181–208 Mark Fishel, Ondˇej Bojar, Daniel Zeman, and Jan Berka r 2011 Automatic Translation Error Analysis...

Ngày tải lên: 16/03/2014, 20:20

... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least three ... GAD a Enter the command show interface serial on GAD Refer to interface chart GAD#show interface serial This will show the details of interface serial b List at least three details discovered by ... the name and passwords for Router a On the Birmingham router, enter the global configuration mode Configure hostname, console, virtual terminal and enable passwords as shown in the previous chart...

Ngày tải lên: 05/11/2013, 12:15

... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config) #interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD...

Ngày tải lên: 11/12/2013, 13:15

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface ... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface...

Ngày tải lên: 11/12/2013, 13:15

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface ... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface...

Ngày tải lên: 11/12/2013, 15:15

... passwords lab Step Configure serial interface Serial From the configure terminal mode, configure serial interface Serial on Router GAD Refer to interface chart GAD(config) #interface serial GAD(config-if)#ip ... about Serial interface on BHM a Enter the command show interface serial on BHM Refer to interface chart BHM#show interface serial This will show the details of interface serial b List at least following ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD...

Ngày tải lên: 18/01/2014, 04:20

... Paris interface as listed Configure the Paris router serial interface as follows: Paris(config) #interface serial Paris(config-if)#ip address 192.168.15.2 255.255.255.0 Paris(config-if)#clockrate ... configurations for each router class What is provided are the identifiers for the possible combinations of interfaces in the device This interface chart does not include any other type of interface ... though a specific router may contain one An example of this might be an ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface...

Ngày tải lên: 24/01/2014, 19:20

... of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified to ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel Cz corresponding ... present a languagemodel enabled interface that is appropriate for the most impaired users In addition, the RSVP paradigm provides some useful interface flexibility relative to the grid-based paradigm...

Ngày tải lên: 20/02/2014, 05:20

... nhanh dễ dàng  So với cách kết nối thiết bị với máy tính dùng cổng song song (Parallel Port), dùng cổng nối tiếp (Serial Port) hay dùng Card đặc biệt thiết kế cài đặt sẵn bên máy tính USB nhanh ... cấu tạo giống 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~  Mạch ASIC ( Application Specific Integrated Circuit ): não ổ đ a Flash USB Nó gồm có xử lý trung tâm 50 MHz ARM7 RISC, quản lý toàn chuyện ghi ... Joystick, Digital Camera, Webcam, Modem, loa, điện thoại, Network Connection, thiết bị lưu trữ thông tin (ổ Zip) 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~  Thông thường máy tính có hai khe cắm USB...

Ngày tải lên: 31/07/2014, 11:20

... ExportP24HEXFile() L ValidateHEXFile() CLEAR SortAndPadFiles() Parse Memory Files and Save as Formatted HEX Files C Sort Memory Files, Pad to Handle Bad HEX Files EraseDataFiles() Clear Data from ... Data EEPROM Operations Some PIC24F devices have built-in data Flash memory EEPROM The bootloader allows data Flash to be read and erased at a word level, bytes at a time Erases are done on a ... data and are not included in the checksum COMMANDS The data field for each packet contains one command and its associated data The commands are detailed in Appendix A: “PIC24F Serial Bootloader...

Ngày tải lên: 11/01/2016, 16:47

... specifications are assumed here, and hardware design and register value settings are conducted accordingly • • • • • • Data transfer mode and level Data transfer speed Data transfer format Multiprocessor ... of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting the same bit count of data It uses ... synchronization: one is for the sender and receiver to use the same data format and the other is for them to use the same transmission speed (also called "baud rate", which refers to how many bits are...

Ngày tải lên: 29/09/2013, 11:20

... size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding the RS-232 and ... course by addition of few more hardware components and using port lines to build a home automation project Program 4.4 Controlling an actuator such as relay from PC HyperTerminal Program Source ... inherent calibration facilitates easy interfacing to the outside world As shown in Fig 4.5 Receiving sensor data on the HyperTerminal 76 Serial Interface to PIC Fig 4.5 only a unity gain amplifer...

Ngày tải lên: 03/10/2013, 01:20

... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... serve as simple search interface for general users, taking advantage of the rich semantic annotation —behind the scenes— for more precise and intelligent retrieval of audiovisual files tions: semantic ... relations All visual data have been labelled by the annotators with one or two-word action or entity denoting tags These labels have resulted from a process of watching only the visual stream...

Ngày tải lên: 22/02/2014, 02:20

... select real-time broadcast programs from 19 channels It also enables the presentation of program in- Internet Digital broadcasting TV program database Individual profile management program Program ... Description any number of any words one word non-matching word optional mandatory any order slots or delimiter In the pattern matching process, categories important to television operations are stored as ... Technologies and Services) A1 Work Package Available at http://sharon.cselt.it/projects/facts -a1 / Hideki Sumiyoshi, Ichiro Yamada, and Nobuyuki Yagi 2002 Multimedia Education System for Interactive Educational...

Ngày tải lên: 31/03/2014, 03:20

... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...

Ngày tải lên: 18/06/2014, 18:20

Ngày tải lên: 18/06/2014, 18:20