use of as a tool to design processing and storage conditions

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and...

Ngày tải lên: 11/08/2014, 00:23

3 381 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... criteria  are  measured.  Another disadvantage is the large amount of pairwise comparisons if many criteria exist.   2.6. Determination of alternatives  Based on the constraints and objectives of ... developed  and applied.  Each  of them  has  its  own  advantages  and disadvantages.  Table  1  summarizes  some  these methods and their features.  In  comparison  with  the  ranking  and rating ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot

... Esposito and I Caputo 132 Akagi A, Tajima S, Ishibashi A, Matsubara Y, Takehana M, Kobayashi S & Yamaguchi, N (2002) Type XVI collagen is expressed in factor XIIIa+ monocyte-derived dermal dendrocytes ... intracellular signalling and apoptosis, as well as in neurodegenerative and autoimmune diseases Consequently, its function may depend on its subcellular and cellular localization and on access to proteins ... Transglutaminasecatalyzed inactivation of glyceraldehydes 3-phosphate dehydrogenase and a- ketoglutarate dehydrogenase complex by polyglutamine domains of pathological length Proc Natl Acad Sci USA 94,...

Ngày tải lên: 30/03/2014, 15:20

17 441 0
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx

Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx

... mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II scores were available ... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...

Ngày tải lên: 12/08/2014, 20:20

6 264 0
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx

... standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from Figure A: original data B: normalised data ... known, these factors can be used to correct the data As was demonstrated in the previous paragraphs, normalisation and standardisation both use correction factors that can lead to ineffective ... simulating data, the overall mean was set to 100 and the standard deviation was set to 10 Factors and condition effects are given in the table The estimated session factors are all close to the factors...

Ngày tải lên: 13/08/2014, 09:21

8 304 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness of ... PEA) and liking of the vanilla beverage at any phase of the study The aim of the present study was to examine the effects of heightened aroma concentration on the pleasantness and intake of a ... (Thomas-Danguin et al., 200 3a) ) Data analysis Repeated measures analysis of variance was used to test the within-subject effect of aroma concentration of the sample (two levels) and the day of eating (three...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part1 pptx

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part1 pptx

... State Auditor to conduct postaudits of the transactions, accounts, programs, and performance of all departments, offices, and agencies of the State of Hawaii and its political subdivisions Background ... or manmade disasters Organization The adjutant general is the head of the department and the director of civil defense for the State He is the commanding general of the Hawaii National Guard and ... enacted, the statutes require that the measure be analyzed by the Office of the Auditor as to its probable effects Health insurance analyses examine bills that propose to mandate certain health...

Ngày tải lên: 18/06/2014, 20:20

10 383 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part2 ppt

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part2 ppt

... Property and Fiscal Office Engineering Office Hawaii Army National Guard Division Administrative Services Office Hawaii Air National Guard Division Public Affairs Office Quality Office Hawaii State ... in accordance with auditing standards generally accepted in the United States of America as set forth by the American Institute of Certified Public Accountants and the standards applicable to ... depreciation Additionally, the department restated the prior-period capital assets balance to reflect additional capital assets that should have been capitalized and depreciated in previous years...

Ngày tải lên: 18/06/2014, 20:20

10 380 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part3 ppt

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part3 ppt

... succeeding paragraph, we conducted our audit in accordance with auditing standards generally accepted in the United States of America and the standards applicable to financial audits contained in ... the accounting principles used and significant estimates made by management, as well as evaluating the overall financial statement presentation We believe that our audit provides a reasonable basis ... Auditing Standards, issued by the Comptroller General of the United States Those standards require that we plan and perform the audit to obtain reasonable assurance about whether the financial...

Ngày tải lên: 18/06/2014, 20:20

10 320 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part4 ppt

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part4 ppt

... Chapter 3: Financial Audit Notes to Basic Financial Statements Explanatory notes that are pertinent to an understanding of the basic financial statements and financial condition of the department ... modified accrual basis of accounting Under the modified accrual basis of accounting, revenues are recorded when susceptible to accrual, that is, both measurable and available, usually when the appropriations ... statement of net assets Capital assets are recorded at cost on the date of acquisition, or if donated, at appraised value on the date of donation Maintenance, repairs, minor replacements, renewals and...

Ngày tải lên: 18/06/2014, 20:20

10 315 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part5 doc

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part5 doc

... record capital assets and the related accumulated depreciation as part of the implementation of GASB Statement No 34 as of June 30, 2002 The cumulative effect of applying this Statement was reported ... reported as a restatement of beginning net assets as of July 1, 2001 During FY2002-03, the department identified additional capital assets that should have been capitalized and depreciated on ... federal funds, and used and managed by the State, which conforms to the GASB Implementation Guide The department further states that it fails to see the value of adopting our recommendation to document...

Ngày tải lên: 18/06/2014, 20:20

10 367 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part6 pot

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part6 pot

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ... version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com ...

Ngày tải lên: 18/06/2014, 20:20

10 290 0
Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part7 pdf

Financial Audit of the Department of Defense A Report to the Governor and the Legislature of the State of Hawaii_part7 pdf

... This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com This is trial version www.adultpdf.com...

Ngày tải lên: 18/06/2014, 20:20

6 362 0
Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part1 doc

Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part1 doc

... enacted, the statutes require that the measure be analyzed by the Office of the Auditor as to its probable effects Health insurance analyses examine bills that propose to mandate certain health ... broad powers to examine all books, records, files, papers, and documents and all financial affairs of every agency The Auditor also has the authority to summon persons to produce records and to ... wish to express our appreciation for the cooperation and assistance extended by officials and staff of the Housing and Community Development Corporation of Hawaii, State of Hawaii Marion M Higa...

Ngày tải lên: 20/06/2014, 02:20

11 330 0
Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part2 docx

Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part2 docx

... Chapter 1: Introduction The Property Management and Maintenance Branch performs management and maintenance of assigned housing and homeless facilities, vacant land, and equipment owned or managed ... federal and state laws, rules and regulations, and policies and procedures To make recommendations as appropriate Scope and Methodology We audited the financial records and transactions and reviewed ... is envisioned to handle virtually all of the corporation’s financial and tenant reporting requirements and move the corporation from a mainframe system to a local area network based system The...

Ngày tải lên: 20/06/2014, 02:20

11 329 0
Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part3 potx

Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part3 potx

... our audit in accordance with auditing standards generally accepted in the United States of America and the standards applicable to financial audits contained in Government Auditing Standards, ... General of the United States Those standards require that we plan and perform This is trial version www.adultpdf.com 19 Chapter 3: Financial Audit the audit to obtain reasonable assurance about ... thereon dated December 8, 2000 We conducted our audit in accordance with auditing standards generally accepted in the United States of America and the standards applicable to financial audits contained...

Ngày tải lên: 20/06/2014, 02:20

11 311 0
Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part4 potx

Financial Audit of the Housing and Community Development Corporation of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 01-14 September 2001_part4 potx

... make estimates and assumptions that affect the reported amounts of assets and liabilities and disclosure of contingent assets and liabilities at the date of the combined financial statements and ... Financial Accounting Standards Board Statements and Interpretations issued after November 30, 1989 Cash and Cash Equivalents Cash and cash equivalents for the purpose of the combined statement of ... continuing appropriations Note C – Cash The State maintains a cash pool that is available to all funds The Director of Finance is responsible for the safekeeping of all monies paid into the State Treasury...

Ngày tải lên: 20/06/2014, 02:20

11 327 0
Financial Audit of the John A. Burns School of Medicine of the University of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-02 May 2002_part1 docx

Financial Audit of the John A. Burns School of Medicine of the University of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Report No. 03-02 May 2002_part1 docx

... Financial Audit of the John A Burns School of Medicine of the University of Hawaii A Report to the Governor and the Legislature of the State of Hawaii Conducted by The Auditor State of Hawaii and ... broad powers to examine all books, records, files, papers, and documents and all financial affairs of every agency The Auditor also has the authority to summon persons to produce records and to ... enacted, the statutes require that the measure be analyzed by the Office of the Auditor as to its probable effects Health insurance analyses examine bills that propose to mandate certain health...

Ngày tải lên: 20/06/2014, 02:20

11 249 0
w