use of a cloned osteoprogenitor cell in spinal fusion
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps
... pregnancy and delivery, and had a history of delay in all areas of her development; she walked late, talked late (age 3) and found mainstream schooling very challenging Patient 4’s parents separated ... cousin Patient 2’s clinical examination showed joint laxity but her neurological examination was normal Patient had a diagnostic assessment for ADHD and was found to have very high scores for inattention, ... best treatment Reliable, cost-effective, predictive factors that can be used in everyday clinical practice are needed Challenges in clinical practice In the specialist ADHD clinic in East and North...
- 24
- 597
- 0
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... vs 50% in metropolitan areas and 44% in rural areas) Finally, parents in the metropolitan and rural areas were both less likely than those in urban areas to have rules against using chat rooms ... and using chat rooms were almost the same Table 7: Which online activities are not allowed? Disclosing Making Talking to Spending a Creating a Using Accessing Downloading Using personal purchases ... Creating a profile in an online community 61 Using chat rooms 49 Accessing certain websites Downloading/playing music, films, games 38 Using email/instant messaging tools 37 Q 7A Some parents are...
- 154
- 399
- 0
báo cáo hóa học:" Dynamic magnetic resonance imaging in assessing lung function in adolescent idiopathic scoliosis: a pilot study of comparison before and after posterior spinal fusion" doc
... reformatted axial image Measurement of AP and TS diameter of the chest wall on the reformatted axial image (a) Upper level at the carina (C), maximal inspiratory image (b) Lower level at the apical vertebra ... Figure Measurement of diaphragmatic heights on the reformatted coronal image Measurement of diaphragmatic heights on the reformatted coronal image (a) At maximal inspiratory image and (b) maximal expiratory ... in children with scoliosis J Bone Joint Surg Br 1985, 67(5):699-702 Kotani T, Minami S, Takahashi K, Isobe K, Nakata Y, Takaso M, Inoue M, Maruta T, Akazawa T, Ueda T, Moriya H: An analysis of...
- 7
- 410
- 0
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc
... proteins (2H2) Mabs (a kind gift of Dr Ferdinando Liprandi, Instituto Venezolano de Investigaciones Científicas, Caracas) and a secondary antibody conjugated to alkaline phosphatase Foci were stained ... can be use as a surrogate, easy and fast method for the semiquantitation of DEN in cultured cells Reliable levels of NS1 protein for quantitation are usually reached in the cell supernatant after ... We thank Ferdinando Liprandi and Lorena Gutierrez for their critical reading of the manuscript and Fernando Medina for technical assistance We also thank Juan José Campos A from Bio-Rad S .A México,...
- 8
- 383
- 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt
... protein and a transcriptional transactivator fusion protein consisting of the GAL4 DNA-binding domain fused to the activation domain of NFκB These effector cells were mixed with a separate set of ... non-essential amino acids, 1.0 mM sodium pyruvate and 10% heat-inactivated, gamma-irradiated fetal bovine serum (FBS) (HyClone Laboratories, Salt Lake City, Utah) AK-D cells (CCL-150) were maintained in ... complicate interpretation The assay described herein is a means of quantifying the fusion activity of the HRSV F protein This assay has multiple applications For example, this assay can be used as a...
- 12
- 541
- 0
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... Küçükdeveci AA, Sahin H, Ataman S, Griffiths B, Tennant A: Issues in cross-cultural validity: Example from the adaptation, reliability and validity testing of a Turkish version of the Stanford Health Assessment ... the validity of the instrument in different diagnostic groups Finally, the use of DIF as a basis for analysing bias in cut points is recommended as a routine assessment where clinical cut points ... normal population http://www.hqlo.com/content/4/1/18 writing of the manuscript AT and AE undertook the data analysis and interpretation, and also participated in writing the manuscript All authors...
- 8
- 448
- 0
Báo cáo y học: "SOX9 transduction of a human chondrocytic cell line identifies novel genes regulated in primary human chondrocytes and in osteoarthritis" docx
... GACAAAGACGTGCACTCAACCTT ACTGTCTAAATTGCCCAGAAATGG SRPX TGGCTGGTTGATTTTGTAGAGAAA TAGAAAAGAGTTAGGTGTCACATTGAATAA SPINT1 CGAGTTGTTTCCTCGCTGATC GCAATGGAATTCAACATAAGCAAA CRTL1 TTCCACAAGCACAAACTTTACACAT GTGAAACTGAGTTTTGTATAACCTCTCAGT ... GTGAAACTGAGTTTTGTATAACCTCTCAGT CRLF1 AACGGCCATAACAGCTCTGACT ACTCAACCAACCCTCACACACA MYBPH AGGCCTACAGTCAAACTCCAGAGA GAAGGGAGGCCAGCAGGTA Page of 10 (page number not for citation purposes) Arthritis Research ... CACTCAGACCCCCACCACAC GATACATGACAAGGTGCGGCT COMP CTGGGCCAACCTGCGTTA CGCAGCTGATGGGTCTCATAG APOD ACGCCCTCGTGTACTCCTGTA TTCCACAAGCACAAACTTTACACAT S10 0A1 CCAGGAGTATGTGGTGCTTGTG ATGTGGCTGTCTGCTCAACTGT RGC32 GACAAAGACGTGCACTCAACCTT...
- 10
- 387
- 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx
... well as facilitate entry into adequate care Key advantages include the ability to draw inference to the population of patients in care for HIV infection, and beginning in 2008, the availability of ... training in medical records abstraction and HIV including OI definitions and AIDS case definition criteria Quality assurance procedures (e.g., independent re-abstraction of a small sample of ... based on race and sex, and sampled within each provider using systematic sampling within race/sex strata from an ordered list The sampling interval was varied in the different race/sex strata...
- 7
- 337
- 0
A potential protective effect of α-tocopherol on vascular complication in spinal cord reperfusion injury in rats pptx
... and 38°C by a thermal pad and a heating lamp The femoral artery was cannulated with a 22-gauge PE catheter, which was used to monitor distal arterial pressure (DAP) and for intra-arterial infusion ... Protamine sulfate (Leo, Ballerup, Denmark); Prostaglandin E2 EIA kit and indomethacin (Cayman Chemical, Ann Arbor, MI, USA) and nitrate reductase from Aspergillus (Sigma) Statistical analysis Data ... constriction of sciatic nerve affecting oxidative stressors and antioxidant enzymes in rat Indian J Med Res 2009, 129:587-592 Naik AK, Tandan SK, Dudhgaonkar SP, Jadhav SH, Kataria M, Prakash VR, Kumar...
- 9
- 240
- 0
Báo cáo y học: " Use of intra-medullary stacked nailing in the reduction of proximal plastic deformity in a pediatric Monteggia fracture: a case report" pptx
... forearm fracture after falling out of a tree His neurovasculature was intact Radiography showed a fracture of the proximal ulnar metaphysis with marked varus angulation and dislocation of the radial ... then advanced down the medulla (Figure 3) A third K-wire was inserted in a similar fashion, resulting in a tight intra-medullary fit that reduced Page of the ulna and the radio-capitellar joint ... Injury 2005, 36:1206-1209 Nakamura K, Hirachi K, Uchiyama S, Takahara M, Minami A, Imaeda T, Kato H: Long-term clinical and radiographic outcomes after open reduction for missed Monteggia fracture-dislocations...
- 5
- 372
- 0
báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps
... Image manipulation was carried out using the manufacturer’s software, Galaxis To increase the accuracy of the assessment, all three planes (sagittal, axial, and coronal) were utilized CBCT images ... resorption of permanent teeth is an inflammation caused by varying factors, including injury to the root surface followed by dental trauma, surgical procedures, non-vital teeth bleaching, and mechanical ... the manufacturer It has a scan time of 14 s and captures the maxilla-mandibular region in a 210° rotation within a radiation-detector configuration The field of view is a spherical volume of 15...
- 5
- 352
- 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx
... temporary shunting of peripheral vasculature in order to maintain distal vascular perfusion is rarely employed in civilian surgical practice [2,3], however, it has been gaining popularity in the management ... Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: Temporary intravascular shunt in complex ... Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery 2004, 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG,...
- 4
- 342
- 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx
... vitro standard external positive sense TCCAGCAAATACACCATCCA In vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 ... ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA ... synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive sense-specific QPCR primer CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific...
- 11
- 348
- 0
Báo cáo y học: " Use of different but overlapping determinants in a retrovirus receptor accounts for non-reciprocal interference between xenotropic and polytropic murine leukemia viruses" ppt
... saline Endogenous alkaline phosphatase was inactivated by incubating the cells at 68°C for h Cells were then stained for alkaline phosphatase activity by incubating the cells over night in AP ... Figure of Analysis AKR6 and 1E virus interference in CHO cells expressing the AAUU and AAAU chimeric receptors Analysis of AKR6 and 1E virus interference in CHO cells expressing the AAUU and AAAU ... pathogenesis have shown that infection of cells by polytropic/MCF viruses results in accumulation of unintegrated extrachromosomal viral DNA, suggesting that P-MLV are capable of superinfecting cells in...
- 12
- 227
- 0
Báo cáo y học: "Secondary prevention of allergic symptoms in a dairy farmer by use of a milking robot" ppsx
... German Professionals insurance laws require a complete elimination of allergens for the recognition of an allergic airway disease as a compensable occupational disease Complete avoidance of occupational ... compensation of occupational allergic asthma as occupational disease [4] Legal consequence would usually be to abandon dairy farming However, in our case presented, dairy farming substantially ... prevent allergic asthma are rare Taivainen et al (1998) demonstrated that due to the use of a dust respirator helmet with a P2-class filter, dairy farmers with occupational asthma induced by cow dander...
- 4
- 279
- 0
Báo cáo y học: " Implementation of a delirium assessment tool in the ICU can influence haloperidol use" doc
... frequency of haloperidol use as a proxy for delirium incidence Data of all patients who were treated with haloperidol are available through our patient data management system As a general rule, in our ... the nursing and medical staff We integrated the CAM-ICU algorithm in our patient data management system, which is available at all bedside computers Because of the fluctuating course of delirium ... four adult wards and one paediatric ward Annually 2000 to 2500 (cardiothoracic surgery, neurosurgical, medical, surgical, and trauma) patients are admitted The local Institutional Review Board of...
- 7
- 291
- 0
Báo cáo y học: "The use of a blood conservation device to reduce red blood cell transfusion requirements: a before and after study" doc
... board, ethics committee approval and manuscript drafting DP was involved in data collection CYH was involved in statistical analysis JP and LTK were involved in manuscript drafting and PL was involved ... lock in place in the fully closed position and all fluids have been reinfused into the arterial line A single device was used for an individual arterial catheter throughout the patient's stay and ... least 0.05 unit PRBC/patient/day with a standard deviation of 0.15 units PRBC/patient/day Statistical analysis We expressed variables as means ± standard deviations and numbers (percentages), and...
- 7
- 317
- 0
A contrastive analysis of moderating criticism The use of disjuncts as mitigating hedges in verbal communication
... Data analysis and findings: This chapter analyses collected data to find out major similarities and differences in the choice of hedging strategies in given situations by Vietnamese learners of ... carried out in different languages and in interlanguage of English learners of different language backgrounds such as House and Kasper (1981), Tracy, Van Dusen, and Robison (1987), Tracy and Eisenberg ... in many other researches In spite of different approaches to the matter, these authors state one thing in common that both vocabulary and grammar are vital aspects in language However,...
- 6
- 555
- 1
Effects and mechanisms of a concentrated goyasaponin fraction in 3t3 l1 cell line
... complications including heart disease, retinal damage, renal failure and stroke [9], it was ranked sixth as the leading cause of death in United States in 2004 [10] In normal subjects, the plasma ... camera (Olympus, Nagano, Japan) 3.6 Cell Lysate Preparation and Protein Concentration Determination Mammalian Cell Lysis / Extraction Reagent (CelLytic-M) and adipocyte lysate was prepared according ... being consumed as a vegetable, M charantia has been used to maintain health, prevent illnesses as well as manage chronic diseases, most notably diabetes, in the traditional medicinal systems of...
- 89
- 271
- 0
The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities
... physician or pharmacy Total medication count included the total number of medicines taken at the point of measurement Vitamins, minerals, basic skin creams (e.g vaseline), or anti-dandruff shampoo ... related to an age-related decline in health Since falls, in the general population, increase with age, this contributes to the explanation that age-related frailty is associated to increased fall ... risk In this study we did not observe an increase in falls with age Also, the explained variance of the model was low (explained variance = 13%) and mainly related to previous falls, indicating...
- 9
- 332
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25