use of a circular oval clipping path

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

Báo cáo y học: "Use of a multi-virus array for the study of human viral and retroviral pathogens: gene expression studies and ChIP-chip analysis" pot

... and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average of the intensity across the array set was then obtained A ratio ... open reading frames of other viruses that are known human pathogens The potential applications of a viral microarray representing pathogenic viruses extends beyond profiling expression of viral genes ... National Institutes of Health (NIAID/NIH) to Fatah Kashanchi Fatah Kashanchi and Steve Jacobson share senior authorship 18 19 20 21 References Hegde P, Qi R, Abernathy K, Gay C, Dharap S, Gaspard...

Ngày tải lên: 13/08/2014, 13:20

15 376 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx

... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...

Ngày tải lên: 21/12/2013, 19:15

2 393 0
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter doc

... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... of measurement For example Vol, voltage, or V If the voltage is negative, reverse the leads Reflection: Name one thing that should not be done to a multimeter _ Name one important...

Ngày tải lên: 18/01/2014, 04:20

2 374 0
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf

... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality ... Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves ... m a t e s of these parameters are obtained, each clause can be assigned the most probable latent category given the tags assigned by the judges The EM algorithm takes as input the number of latent...

Ngày tải lên: 23/03/2014, 19:20

8 354 0
báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx

báo cáo hóa học: " A pilot study evaluating use of a computer-assisted neurorehabilitation platform for upper-extremity stroke assessment" pptx

... area in this task was thus large, consisting of a screen-centered rectangle with 40% width and height of the workspace Data and statistical analysis Representative tasks were analyzed across subjects ... horizontal and vertical settings [35-37], and incorporate a larger range of Page of 15 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation 2009, 6:15 motion that can ... The Range of Capacity (ROC) toolbox can be used to assess the user's initial and final capability ROM when using an input device and optionally used to map between the input device workspace range...

Ngày tải lên: 19/06/2014, 08:20

15 361 0
Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

Báo cáo hóa học: " Characterization of an Egyptian Spodoptera littoralis nucleopolyhedrovirus and a possible use of a highly conserved region from polyhedrin gene for nucleopolyhedrovirus detection" potx

... AAGCCCGATACGATGAAGCTGATCGTCAACTGGAACGGCAAAGAGTTTCTCCGTGAGACT |||||||| || ||||||||| | || ||||||| |||||||||||||||| | || ||| AAGCCCGACACCATGAAGCTGGTAGTAAACTGGAGCGGCAAAGAGTTTCTCAGGGAAACT 64 TGGACCCGTTTCATGGAAGACAGCTTCCCCATCGTGAACGATCAAGAAGTGATGGACGTG ... -GTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAGAAAGGTGGCGGCT || |||||| || | |||||| |||||||||||||| || |||||||| || ||||||| 1723 CGT-GTACGTAGGAAACAACAACGAATACCGCATCAGCCTGGCCAAGAAGGGCGGCGGCT 301 302 GTCCC-GTGATGAACCTGCACGCCGAATACAC-CACTTCGTTTGA-GAGTTTCATCGACA ... CCGTCGTACGTCGGCACCAACAATGAATACCGCATCAGTCTCGCCAAG P S Y V G T N N E Y R I S L A K AAAGGTGGCGGCTGTCCCGTGATGAACCTGCACGCCGAATACACCACT K G G G C P V M N L H A E Y T T TCGTTTGAGAGTTTCATCGACAAGGTGATATGGTACAACTTTTACAAG S F E...

Ngày tải lên: 20/06/2014, 01:20

11 854 0
Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

Báo cáo hóa học: " Use of a commercial enzyme immunoassay to monitor dengue virus replication in cultured cells" doc

... that the Platelia™ Dengue NS1 AG assay can be use as a surrogate, easy and fast method for the semiquantitation of DEN in cultured cells Reliable levels of NS1 protein for quantitation are usually ... search of alternative semiquatitative methods Recently, a flow cytometrybased assay and a fluorescent focus assay for flavivirus quantitation have been reported [10,11] Results An attractive alternative ... We thank Ferdinando Liprandi and Lorena Gutierrez for their critical reading of the manuscript and Fernando Medina for technical assistance We also thank Juan José Campos A from Bio-Rad S .A México,...

Ngày tải lên: 20/06/2014, 01:20

8 384 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt

... from a known infectious cDNA sequence for subgroup A, A2 strain, [34] was synthesized with optimal codon usage for expression in mammalian cells and all potential polyadenylation sites (AATAAA) and ... non-essential amino acids, 1.0 mM sodium pyruvate and 10% heat-inactivated, gamma-irradiated fetal bovine serum (FBS) (HyClone Laboratories, Salt Lake City, Utah) AK-D cells (CCL-150) were maintained ... (pGL3-control), and relative luciferase activity was measured To account for potential differences in host cell transcription factors that mediate activation of the reporter plasmid, the assay was flipped and...

Ngày tải lên: 20/06/2014, 04:20

12 541 0
USE OF A SOAKING PROCEDURE TO IMPROVE DRY BEAN ATTRIBUTES - MILESTONE 7 pdf

USE OF A SOAKING PROCEDURE TO IMPROVE DRY BEAN ATTRIBUTES - MILESTONE 7 pdf

... between days and in treatment five, pH and titrable acidity values of pulp had an apparent anomaly of both rising from day to in this treatment This may be associated with a change in organic acid ... on each day of the fermentation sampled pH values tended to decrease with length of fermentation time West African cocoa usually has a pH of around 5.1 The results indicate that a fermentation ... for each day of all fermentation treatments It can also be noted that the lower the pH of un-washed cocoa is, the greater the elevation of pH caused by washing With un-washed cocoa, it was surprising...

Ngày tải lên: 21/06/2014, 06:20

22 220 0
Cutting Tool Materials What is the use of a book docx

Cutting Tool Materials What is the use of a book docx

... plotted against hardness to indicate the range of influence of each tool material and the comparative relative merits of one material against another, with some of their physical and mechanical properties ... crystalline grains can be either ‘beta-Sialon’ , or a mixture of ‘alpha’ and ‘beta’ , but generally it can be said that as the ‘alpha’ phase increases, the hardness of the ‘Sialon’ becomes greater ... single-crystal diamond (SCD), is the hardest material available today If such natural dia- 30 Chapter • Natural diamond – has a hardness of 9,000 kg mm–2 (ie diamond orientation and test conditions): Diamond...

Ngày tải lên: 27/06/2014, 23:20

31 456 0
Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf

Báo cáo toán học: "Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover" pdf

... journal of combinatorics 16 (2009), #R81 For any root θ of µ(G, x), it was shown by Neumaier [6, Corollary 3.3] that the analogue of Gallai’s Lemma holds when G is a tree A different proof was given ... Theorem 1.2 If G has a Hamiltonian path, then all roots of its matching polynomial are simple The above is the source of motivation for our work It is natural to ask when does equality holds in ... the idea of the proof of Theorem 5.3 in [3], we shall prove the Stability Lemma for trees with any given root of its matching poynomial Note that the Stability Lemma is a weaker statement than Theorem...

Ngày tải lên: 07/08/2014, 21:21

12 287 0
Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps

Báo cáo y học: "Clinical use of a modified release methylphenidate in the treatment of childhood attention deficit hyperactivity disorder" pps

... in managing the child’s behaviour and psychoeducational materials are made available When pharmacological therapy is recommended, the various types of medication available and their risks and ... medication effect wears off and children eat normally Children are usually advised to eat a substantial breakfast before taking their medication and most are able to eat a healthy portion of food in the ... delivery, and had a history of delay in all areas of her development; she walked late, talked late (age 3) and found mainstream schooling very challenging Patient 4’s parents separated when she was...

Ngày tải lên: 09/08/2014, 01:21

24 599 0
Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

Báo cáo y học: "Use of a population-based survey to determine incidence of AIDS-defining opportunistic illnesses among HIV-positive persons receiving medical care in the United States" ppsx

... States, significant variations in clinical care may exist because of differences in reimbursement sources and in availability of treatment resources in different states [12], and because of varying ... AIDS case to the health department; some providers of care may have been left off the sampling frame if they had never reported an HIV case However, two of the participating states had laboratory ... representativeness of data compared with data from electronic medical records In some cases, our estimates are comparable to rates estimated from observational cohorts; for example, we estimated that the annual...

Ngày tải lên: 10/08/2014, 05:20

7 337 0
Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

Báo cáo y học: "Severe leukocytoclastic vasculitis secondary to the use of a naproxen and requiring amputation: a case report" ppt

... clinical, laboratory, and multispecialty collaboration, no alternative diagnosis applied to our patient We reiterate that amputation in this scenario was an unfortunate and Page of debilitating last ... disease Noting the atypical nature of the case of LCV or HSV, the authors feel that the realization of paucity of cases with more severe outcomes may encourage additional research in the area of ... during active inflammatory disorders of vessels [16] Conclusion We have presented an atypical case of leukocytoclastic vasculitis in a 33-year-old African American woman secondary to the use of naproxen...

Ngày tải lên: 11/08/2014, 11:20

7 469 0
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf

... intrauterine pregnancies but not ectopic pregnancies remains unknown Figure (A) Transvaginal ultrasound of the cornual pregnancy (B) Detailed clarification of the ultrasound in (A) Page of (page ... the data regarding cornual pregnancy and was a major contributor in writing the manuscript Both authors approved the final manuscript Although non-surgical treatment of cornual pregnancies faces ... failure rates than treatment of ampullary pregnancies [12], we adopted this non-surgical management since there was no acute emergency (of a ruptured ectopic pregnancy) In addition, a surgical...

Ngày tải lên: 11/08/2014, 14:20

4 341 0
báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps

báo cáo khoa học: " A radiographic analysis of tooth morphology following the use of a novel cyclical force device in orthodontics Chung H Kau" pps

... Image manipulation was carried out using the manufacturer’s software, Galaxis To increase the accuracy of the assessment, all three planes (sagittal, axial, and coronal) were utilized CBCT images ... evaluating root resorption is through conventional radiography Some examples are panoramic radiography or peri-apical films However, these models may be of limited use A more Page of accurate ... surrounding bony areas facilitating a variable response to tooth movement [5] In another study, it has been reported that low magnitude mechanical signals are “anabolic” to bone when applied at a high...

Ngày tải lên: 11/08/2014, 20:21

5 352 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

... 38:175-184 Husain AK, Khandeparkar JM, Tendolkar AG, Magotra RA, Parulkar GB: Temporary intravascular shunts for peripheral vascular trauma J Postgrad Med 1992, 38(2):68-69 Sriussadaporn S, Pak-art R: ... behalf of the East of Scotland Vascular Network References Yagubyan M, Panneton JM: Axillary artery injury from humeral neck fracture: A rare but disabling traumatic event Vasc Endovascular Surgery ... idea behind the case report, was senior editor of the manuscript (critical revisions) and gave final approval 12 13 14 15 Stahnke M, Duddy MJ: Endovascular repair of a traumatic axillary artery...

Ngày tải lên: 11/08/2014, 21:22

4 342 0
báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps

báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps

... six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing the caregiver to rate their child QOL on a 10-point scale This was Descriptive statistics were generated ... Setting and study population In May-June 2008, a telephone survey was conducted in a stratified sample of households in all Canadian provinces by a contracted company using random-digit dialling ... recurrent AOM on the QOL of parents and families [10,11] Four domains of the caregiver’s life are covered (sleep deprivation, change of daily and social activities, emotional distress, cancelling family...

Ngày tải lên: 12/08/2014, 01:21

7 311 0
Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

Báo cáo y học: "Use of a highly sensitive strand-specific quantitative PCR to identify abortive replication in the mouse model of respiratory syncytial virus disease" pptx

... CGGTCATGGTGGCGAATAA Probe TCCTGCAAAAATCCCTTCAACT QPCR tag primer CCCCACTTTATAGATGTTTTTGTTCA Negative sense-specific QPCR primer FAM-TTGGTATAGCACAATCTTCTACCAGAGGTGGC-TAMRA Sequence contains an EcoRI ... ATAGGATCCTGCTAAGACTCCCCACCGTAA2 Positive sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAATCCTGCAAAAATCCCTTCAACT3 Negative sense RNA-specific cDNA synthesis CGGTCATGGTGGCGAATAAACTTTATAGATGTTTTTGTTCA3 Positive ... vitro standard external negative sense CTGCTTCACCACCCAATTTT In vitro standard nested positive sense ATAGAATTCGGTATGTTATATGCGATGTCTAGGT1 In vitro standard nested positive sense ATAGGATCCTGCTAAGACTCCCCACCGTAA2...

Ngày tải lên: 12/08/2014, 01:22

11 348 0
w