Mac Kung Fu pot
... reference to trackpad gestures In nearly all cases these require a multitouch trackpad, such as the standalone Magic Trackpad or the glass “buttonless” trackpads that have been featured in the MacBook ... windows of a particular app to a new space by clicking and dragging the program’s icon to the alternative space The icon appears beneath the window previews Navigating Easily Using the Keyboard I ... in each case, once you’ve activated the secret setting, you need to scroll up to activate (that is, to make the stack expand), and then scroll down to deactivate (to make the stack hide again)...
Ngày tải lên: 06/03/2014, 20:20
... situation The West then mounted a propaganda attack against Russia, with the American news media leading the way The news coverage has been far from fair and balanced, especially during the first ... respected And that is the protection of human rights Since the end of Cold War the West has used and abused international law to advance its geopolitical advantage (and usually against Russia’s legitimate ... geopolitical risk analysis company The assumption that everybody made was that a mere guarantee by NATO would preclude any threat because the Russians would never dare displease NATO or the United States,”...
Ngày tải lên: 19/07/2013, 16:34
... especially as shameful one who is fanatically devoted to a cause 27 ot THEATER TALK Let's try a little talk about the theater The play is a musical about a hero who tries several ploys to win the ... both a pheasant-like game bird and a complaint Add irant to the snake that bit Cleopatra for a word meaning a political candidate This red bird is also indispensable 10 To a male sheep, add ification ... time) The two parties have to the agreement (formally approve) If you water that plant, it may be (brought back to life) The art exhibit was a Chagall (all his past work) Sparrows are in England...
Ngày tải lên: 31/08/2013, 14:24
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... stewed tomatoes and unsalted tomato sauce, garlic, basil, and oregano to a saucepan (use a potato masher to mash up stewed tomatoes in the pan) Let simmer Brown the chopped meat and strain any fat, ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation:serve with tomatoes, guacamole, ... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf
... represent atomic operations These atomic operations then become states in a state machine Each time the machine transitions into a new state, the variables that make up the state of the application are ... favor locations that minimize the amount of area fragmentation because fragmented area is not available for new applications How will the new network topology interact if we allow the allocator ... considered a rectangular region, and hardware tasks are polygons defining an area which contain the resources necessary to run a particular task, the allocation problem can be reduced to a geometric packing...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx
... corpora to calculate phrase translation probabilities 4.1 Applied to parallel corpora In order to adapt suffix arrays to be useful for statistical machine translation we need a data structure with the ... and easily searchable The total size of the suffix array is a constant amount of memory Typically it is stored as an array of integers where the array is the same length as the corpus Because it ... is organized alphabetically, any phrase can be quickly located within it using a binary search algorithm Yamamoto and Church (2001) show how to use suffix arrays to calculate a number of statistics...
Ngày tải lên: 17/03/2014, 05:20
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx
... Hiratzka LF, Hunt SA, Jacobs AK; American College of Cardiology; American Heart Association Task Force on Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management ... contrast to pharmacoinvasive therapy, the strategy of facilitated PCI relies on the idea that early initiation of pharmacotherapy (GP IIb/IIIA receptor blockers and/or thrombolytics) may lead to a more ... was proposed very early on to advance the start of treatment to prehospital care by the EMS (50) The GISSI I trial was the first mega trial to test the standard dose of 1.5 Mill U streptokinase...
Ngày tải lên: 18/06/2014, 12:20
Tài liệu The Time Machine pptx
... another moment came to- morrow The laboratory grew faint and hazy, then fainter and ever fainter To- morrow night came black, then day again, night again, day again, faster and faster still An eddying ... have a big machine nearly finished in there’—he indicated the laboratory—‘and when that is put together I mean to have a journey on my own account.’ ‘You mean to say that that machine has travelled ... me to be calm and patient, to learn the way of the people, to get a clear idea of the method of my loss, and the means of getting materials and tools; so that in the end, perhaps, I may make another.’...
Ngày tải lên: 21/02/2014, 14:20
Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt
... the translations of the same Chinese sentence as paraphrases We obtained all the possible paraphrase pairs and we added an equal number of randomly selected non paraphrase pairs, which contained ... were the seeds cooccur, and uses the contexts as patterns that can express the relation; the patterns are then used to locate new named entities that satisfy the relation, and a new iteration ... particularly useful in bootstrapping paraphrase generation approaches (Riloff and Jones, 1999; Barzilay and McKeown, 2001; Ravichandran and Hovy, 2001; Ravichandran et al., 2003; Duclaye et al.,...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt
... Cowan and Collins (2005), i.e we add a CP and SBAR nodes to subordinate and relative clauses This is undone in parser output The category labels in the Spanish treebank are rather fine grained and ... in the vicinity of target node can have negative impact, greater reliance on context means greater susceptibility to parse errors Another factor to consider is the fact that we trained and adjusted ... 5) can be attributed to two main factors Firstly, the mapping from Cast3LB tags to LFG grammatical functions is not one -to- one For example three Cast3LB tags (CC, MOD and ET) are all mapped to...
Ngày tải lên: 08/03/2014, 02:21
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ∪ P0 ), n n area(Pqn+1 ∪ Pqn+1 ), area(Qn ... that an /bn is bounded from above by a constant which is asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically universal ... notion can be extended to arbitrary domains on the sphere C; it suffices to replace the Euclidean area with the spherical area in the growth condition (2.7) David proved that the analogue of the measurable...
Ngày tải lên: 14/03/2014, 22:20
The time machine
... travelled back to the land of the Eloi and Morlocks He has arrived at the beginning of Chapter 12 He is with Weena again, and they are looking for a safe place He wants Weena to be safe this time What ... into pairs They imagine that they work for a travel company in the future Ask them to prepare and write an advertisement for a holiday in the Land of the Eloi Why would it be The Holiday of a ... groups Ask them to imagine that they are going to travel 1,000 years into the future Ask them to discuss these questions (a) Are they going to enjoy the experience? Why/why not? (b) What will they...
Ngày tải lên: 20/03/2014, 15:49
The Time Machine pot
... have told Blank, and Dash, and Chose about the machine?' he said to me, leaning back in his easy-chair and naming the three new guests 'But the thing's a mere paradox,' said the Editor 'I can't ... and hazy, then fainter and ever fainter To- morrow night came black, then day again, night again, day again, faster and faster still An eddying murmur filled my ears, and a strange, dumb confusedness ... seemed to watch me; there was the faint shadow of a smile on the lips It was greatly weather-worn, and that imparted an unpleasant suggestion of disease I stood looking at it for a little space half...
Ngày tải lên: 22/03/2014, 23:20
Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt
... you have already shown a screen output to this particular user in any previous turn (i.e screenUser > 1), then so again if the previous user speech act was a command (i.e userSpeechAct=command) ... turn (also not available at runtime) To find the context type which provides the richest information to a classifier, we compared the accuracy achieved in a 10-fold cross validation by a Na¨ve Bayes ... Bayes classifier (as a standard) on these ı data sets against the majority class baseline, using a paired t-test, we found that that for context and context 4, Na¨ve Bayes shows a significant ı improvement...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf
... examples are used to train the classifiers and then, unlabelled examples are presented to the classifiers Examples that cause the classifiers to disagree are good candidates to retrain the classifiers ... rather small (3,059 names) At the partial matching sub-stage, classified names are matched against unclassified ones aiming at the recognition of the truncated or variable forms of names 3.2 The ... database Another example is “Orange” already included in the lexicon as an old French city In the meanwhile, a new French company has been created having the same name, as in the example “Orange,...
Ngày tải lên: 23/03/2014, 19:20
It is time for us to check in for our flight ppt
... nguyên thể có to (to Verb) cụ thể to check in” - “our”- chúng tôi, chúng ta; tính từ sở hữu đứng trước danh từ để bổ sung ý ngh a cho danh từ - “flight”- chuyến bay; danh từ theo sau tính từ sở ... “our flight”chuyến bay chúng ta/ chuyến bay - Lưu ý: cấu trúc “It’s time (for somebody) to something” - có ngh a đến lúc người làm việc Cần phân biệt với cấu trúc “It’s (about/ high) time (for ... *It is time for us to check in for our flight Hình thức cấu trúc ngữ pháp: “It’s time (for somebody) to something” - đến lúc người làm việc Chúng ta quan sát câu sau Các bạn di chuột vào...
Ngày tải lên: 25/03/2014, 03:20
Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx
... newspaper) financial version 600 cases are labeled manually and 100 left unlabeled Among those labeled, 400 are used as training data, 100 as test data and the rest as held-out data 4.1 Use of ... A3 , , An ) p (c | A1 , A2 , A3 , , An ) (4) (5) Apply Bayesian rule to (5), we have: score(c | A1 , A2 , A3 , , An ) = p (c | A1 , A2 , A3 , , An ) p (c | A1 , A2 , A3 , , An ) n = p( A1 , A2 ... of the labeled cases and unlabeled cases is prepared The labeled cases are separated into three parts, training cases, test cases and held-out cases Loop: While the breaking criteria is not satisfied...
Ngày tải lên: 31/03/2014, 03:20
Breaking the Time Barrier How to Unlock Your True Earning Potential
... put a value on something as vague as updating a look? So I began to ask them why they wanted to update their 43 site They told me they thought the look and feel of it was outdated and probably ... to evaluate vendors That’s because the deciding factor becomes who can deliver value rather than price And because I’m the one who’s helped the client gain that clarity, I have a leg up on the ... out and doesn’t take vacations Mack’s the opposite He’s got a huge house, fancy car and leases a big office downtown He also spends lavishly and travels the world They both 26 use a cost-plus approach...
Ngày tải lên: 26/05/2014, 22:02
time machine 1 secret of the knights
... ho, away! Haul away, my Rosie,” the sailors sing With each O sound they give the capstan a push “Weigh ho away, haul away Joe.” The captain rings a brass bell on top of the forecastle when the anchor ... called Providence in the Caribbean was established on a small island near Nicaragua It was destroyed by the Spanish in 1641 Soon afterward, the town of New Providence was built in the Bahamas ... they used several islands as bases, including Port Royal, Jamaica Port Royal sank into the sea after an earthquake in 1692 6) A privateer is a kind of pirate licensed by one king to raid the ships...
Ngày tải lên: 31/05/2014, 01:29