use a different animation with dock stacks

Mac Kung Fu pot

Mac Kung Fu pot

... Programmers, LLC was aware of a trademark claim, the designations have been printed in initial capital letters or in all capitals The Pragmatic Starter Kit, The Pragmatic Programmer, Pragmatic ... Trackpad When a Mouse Is Attached Install Only Printer Drivers and Not Their Add-ins Send Somebody a Link to an App Get a Bigger Search Area in Safari Copy Calculator Results Bookmark Images and ... trackpad gestures In nearly all cases these require a multitouch trackpad, such as the standalone Magic Trackpad or the glass “buttonless” trackpads that have been featured in the MacBook range...

Ngày tải lên: 06/03/2014, 20:20

318 5,6K 0
Once Its rationale, collective defense poses new challenge to a larger NATO

Once Its rationale, collective defense poses new challenge to a larger NATO

... be blamed for worsening the situation The West then mounted a propaganda attack against Russia, with the American news media leading the way The news coverage has been far from fair and balanced, ... and abused international law to advance its geopolitical advantage (and usually against Russia’s legitimate security interests) The human rights factor is not part of the West’s international ... China was concerned about “the latest development in South Ossetia and Abkhazia,” AgenceFrance Presse reported And the Russian ambassador to Macedonia told reporters that he had asked the authorities...

Ngày tải lên: 19/07/2013, 16:34

35 308 0
The vocabulary builder : The Practically Painless Way to a Larger Vocabulary

The vocabulary builder : The Practically Painless Way to a Larger Vocabulary

... both a pheasant-like game bird and a complaint Add irant to the snake that bit Cleopatra for a word meaning a political candidate This red bird is also indispensable 10 To a male sheep, add ification ... brand, especially as shameful one who is fanatically devoted to a cause 27 ot THEATER TALK Let's try a little talk about the theater The play is a musical about a hero who tries several ploys to ... scare talk that is galvanizing the nucleardisarmament advocates (a) coating (b) leading (c) frightening (d) arousing i "To have great appeal," she said, "her plan must be simple, effective, and...

Ngày tải lên: 31/08/2013, 14:24

163 659 2
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx

... Salads and Salad Dressings 18 Mixed Green Salad with Strawberry Dressing 18 Black Bean Salad 18 Egg Salad 18 Bavarian Potato Salad 19 Greens with Vinaigrette 19 Orzo Salad 19 Pasta and Pea Salad ... Salad with Marjoram-Scented 19 Vinaigrette 19 Pasta Salad 20 Shoepeg Corn Salad 20 Spanish Potato Salad 20 Spinach Apple Salad 20 Tangy Coleslaw 21 Warm Spinach Salad 21 Tabouli (Wheat Salad) ... Spinach Salad 21 Chicken Salad 22 Chicken Rice Salad 22 Danish-Style Carrot Salad 22 Tomato-Basil Pasta Salad 22 Easy Chicken Salad 23 Charlie's Chicken Salad 23 Cole Slaw 23 Blender Mayonnaise...

Ngày tải lên: 22/03/2014, 16:21

123 392 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...

Ngày tải lên: 18/06/2014, 16:20

9 568 0
Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf

Báo cáo hóa học: " Using Simulated Partial Dynamic Run-Time Reconfiguration to Share Embedded FPGA Compute and Power Resources across a Swarm of Unpiloted Airborne Vehicles" pdf

... unloading of circuits on an FPGA using an operating system Checkpointing has been used as a means to allow simulated partial dynamic reconfiguration in the absence of a practical partial dynamic ... FPGAs are an appropriate platform for small UAVs because they have low power requirements yet can compute high complexity tasks such as image processing Small UAVs are best arranged as swarms ... rectangular region, and hardware tasks are polygons defining an area which contain the resources necessary to run a particular task, the allocation problem can be reduced to a geometric packing...

Ngày tải lên: 22/06/2014, 22:20

12 392 0
Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx

Báo cáo khoa học: "Scaling Phrase-Based Statistical Machine Translation to Larger Corpora and Longer Phrases" pptx

... considerable advances in translation quality with the introduction of phrase-based translation By increasing the size of the basic unit of translation, phrase-based machine translation does away with ... NIST2004 large data track translation including the joint probability phrasebased model (Marcu and Wong, 2002) and a variant on the alignment template approach (Och and Ney, 2004), and contrast them ... it using a binary search algorithm Yamamoto and Church (2001) show how to use suffix arrays to calculate a number of statistics that are interesting in natural language processing applications They...

Ngày tải lên: 17/03/2014, 05:20

8 316 0
Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

Most cases of STEMI are caused by a thrombotic occlusion of a larger coronary artery (5). The pptx

... Practice Guidelines; Canadian Cardiovascular Society ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction: a report of the American College of Cardiology/American ... treatment of the combination of clopidogrel plus ASA compared to ASA alone has been proven in patients with unstable angina and non-ST-elevation myocardial infarction with or without percutaneous ... chapter since it is not available in the EU and North American market Enoxaparin for days was tested with fibrinolysis utilising streptokinase, alteplase, reteplase and tenecteplase, and was...

Ngày tải lên: 18/06/2014, 12:20

12 323 1
Tài liệu The Time Machine pptx

Tài liệu The Time Machine pptx

... lamp, and in another moment came to-morrow The laboratory grew faint and hazy, then fainter and ever fainter To-morrow night came black, then day again, night again, day again, faster and faster ... Time, any more than a savage or an animal has of staying six feet above the ground But a civilized man is better off than the savage in this respect He can go up against gravitation in a balloon, ... a balance as they can We improve our favourite plants and animals —and how few they are—gradually by selective breeding; now a new and better peach, now a seedless grape, now a sweeter and larger...

Ngày tải lên: 21/02/2014, 14:20

120 548 0
Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt

Báo cáo khoa học: "Paraphrase Recognition Using Machine Learning to Combine Similarity Measures" ppt

... data to evaluate its predictive power After feature selection, the classifier was trained on all the training data, and it was evaluated on separate test data With large feature sets, an exhaustive ... particularly useful in bootstrapping paraphrase generation approaches (Riloff and Jones, 1999; Barzilay and McKeown, 2001; Ravichandran and Hovy, 2001; Ravichandran et al., 2003; Duclaye et al., ... the translations of the same Chinese sentence as paraphrases We obtained all the possible paraphrase pairs and we added an equal number of randomly selected non paraphrase pairs, which contained...

Ngày tải lên: 08/03/2014, 01:20

9 402 0
Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt

Báo cáo khoa học: "Using Machine-Learning to Assign Function Labels to Parser Output for Spanish" ppt

... Processing, Vancouver, B.C., Canada A L Berger, V J Della Pietra, and S A Della Pietra 1996 A maximum entropy approach to natural language processing Computational Linguistics, 22(1):39–71, March R ... Association for Computational Linguistics, pages 319–326, Barcelona, Spain Acknowledgements M Civit 2004 Gu a para la anotaci´ n de las funciones ı o sint´ cticas de Cast3LB Technical report Availa ... O’Donovan, A Bodomo, J van Genabith, and A Way 2004 Treebank-based acquisition of a Chinese LexicalFunctional Grammar In Proceedings of the 18th Pacific Asia Conference on Language, Information and Computation...

Ngày tải lên: 08/03/2014, 02:21

8 375 1
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt

... π/3 with S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... rational maps with Siegel disks; see for example [P2] and [Mc2] for the case of quadratic polynomials, and [Z1] and [YZ] for variants in the case of cubic polynomials and quadratic rational maps ... asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically universal Finally, let {an = an (x)} and {bn = bn (x)} depend on a parameter x...

Ngày tải lên: 14/03/2014, 22:20

53 383 0
The time machine

The time machine

... Palace of Green Porcelain (a derelict museum) and finds more matches and a metal bar which he can use as a weapon That night, running away from the Morlocks through a dark wood, he accidentally ... into pairs to discuss and write this imaginary story The Time Traveller has travelled back to the land of the Eloi and Morlocks He has arrived at the beginning of Chapter 12 He is with Weena again, ... again, and they are looking for a safe place He wants Weena to be safe this time What does he differently? Put students into pairs They imagine that they work for a travel company in the future Ask...

Ngày tải lên: 20/03/2014, 15:49

51 814 0
The Time Machine pot

The Time Machine pot

... any more than a savage or an animal has of staying six feet above the ground But a civilized man is better off than the savage in this respect He can go up against gravitation in a balloon, and ... The laboratory grew faint and hazy, then fainter and ever fainter To-morrow night came black, then day again, night again, day again, faster and faster still An eddying murmur filled my ears, and ... humanity over Nature had followed another Things that are now mere dreams had become projects deliberately put in hand and carried forward And the harvest was what I saw! 'After all, the sanitation...

Ngày tải lên: 22/03/2014, 23:20

83 419 0
Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt

Báo cáo khoa học: "Using Machine Learning to Explore Human Multimodal Clarification Strategies" ppt

... information to a classifier, we compared the accuracy achieved in a 10-fold cross validation by a Na¨ve Bayes classifier (as a standard) on these ı data sets against the majority class baseline, ... (where we treat feature optimisation as an integral part of the training process) All experiments are carried out using 10fold cross-validation We take an approach similar to (Daelemans et al., 2003) ... often the wizard had already shown a screen output (screenUser) and how many CRs were already asked (CRuser); how much the user’s speech was corrupted on average (delUser), i.e an approximation of...

Ngày tải lên: 23/03/2014, 18:20

8 373 0
Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf

Báo cáo khoa học: "Using Machine Learning to Maintain Rule-based Named-Entity Recognition and Classification Systems" pdf

... company has been created having the same name, as in the example “Orange, valorisée par les analystes” (Orange, estimated by analysts) Also in this case, the lexicon must be updated with a second ... consists of a lexicon and a grammar The lexicon is a set of NEs that are known beforehand and have been classified into semantic classes The grammar is used to recognize and classify NEs that are not ... special symbols and punctuation marks At the separation substage, possible NEs that are likely to contain more than one NE or a NE attached to a nonNE, are detected and attachment problems are...

Ngày tải lên: 23/03/2014, 19:20

8 400 0
It is time for us to check in for our flight ppt

It is time for us to check in for our flight ppt

... tính từ sở hữu đứng trước danh từ để bổ sung ý ngh a cho danh từ - “flight”- chuyến bay; danh từ theo sau tính từ sở hữu “our” “our flight”chuyến bay chúng ta/ chuyến bay - Lưu ý: cấu trúc “It’s ... ngh a đến lúc người làm việc Cần phân biệt với cấu trúc “It’s (about/ high) time (for somebody) + Ved/ cột 2” - Lẽ bạn nên làm hay bắt đầu làm công việc Chúng ta dùng cấu trúc để phê phán hay ... flight It is long after the checking time (Lẽ nên làm thủ tục cho chuyến bay Đã làm thủ tục lâu rồi) > Dịch câu ngh a: Đã đến lúc làm thủ tục cho chuyến bay Bài học liên quan: Nếu không hiểu...

Ngày tải lên: 25/03/2014, 03:20

5 513 0
Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx

Báo cáo khoa học: "Applying Machine Learning to Chinese Temporal Relation Resolution" pptx

... (5) Apply Bayesian rule to (5), we have: score(c | A1 , A2 , A3 , , An ) = p (c | A1 , A2 , A3 , , An ) p (c | A1 , A2 , A3 , , An ) n = p( A1 , A2 , A3 , , An | c) p(c) ≈ p( A1 , A2 , A3 , , An ... those labeled, 400 are used as training data, 100 as test data and the rest as held-out data 4.1 Use of Linguistic Features As Classification Attributes The impact of a temporal indicator is ... performance than Quinlan’s information gain ratio in our experiments Compared with Quinlan’s information gain ratio, Lopez’s dis- tance-based measurement is unbiased towards the attributes with a large...

Ngày tải lên: 31/03/2014, 03:20

7 276 0
Breaking the Time Barrier How to Unlock Your True Earning Potential

Breaking the Time Barrier How to Unlock Your True Earning Potential

... Tara that she go away, think some more, and then develop some packages with all the valuable things she could offer me “Tara came back a week later and presented me with three distinct packages ... know Arty runs a lean operation He works out of his apartment and keeps all his costs as low as possible He’s super frugal Doesn’t own a car, rarely eats out and doesn’t take vacations Mack’s ... come back to me another time so we could start our relationship anew She did and here is what happened “Tara came back after a weekend of thinking and started asking me about my dog and why I wanted...

Ngày tải lên: 26/05/2014, 22:02

70 433 1
time machine 1 secret of the knights

time machine 1 secret of the knights

... Hispaniola 5) After the buccaneers began raiding ships, they used several islands as bases, including Port Royal, Jamaica Port Royal sank into the sea after an earthquake in 1692 6) A privateer ... ho, away! Haul away, my Rosie,” the sailors sing With each O sound they give the capstan a push “Weigh ho away, haul away Joe.” The captain rings a brass bell on top of the forecastle when the anchor ... says to the captain, a stocky man named Broadstreet, and stalks off Broadstreet stares after him, amused “He’s not that bad a chap, really, but he’s got a lot to learn.” The captain puffs on...

Ngày tải lên: 31/05/2014, 01:29

130 447 0
w