use a combo box with the dealer id
Báo cáo khoa học: The potyviral virus genome-linked protein VPg forms a ternary complex with the eukaryotic initiation factors eIF4E and eIF4G and reduces eIF4E affinity for a mRNA cap analogue ppt
Ngày tải lên :
23/03/2014, 10:21
... Fmax ) F as a function of the amount of ligand added For the sake of comparison between various sets of data, the fluorescence decrease was normalized to Y ¼ ) (F ⁄ Fmax) At ligand saturation, a ... Lane 3, as a control, the plant soluble extract was incubated with nonfused recombinant GST and mixed with glutathione–Sepharose 4b After being washed, the fraction eluted with glutathione was ... composition of the complexes They mainly contained three groups of polypeptide chains according to their relative molecular masses: a group with bands in the range of 180 kDa, a 54-kDa band, and a single...
- 11
- 489
- 0
báo cáo hóa học:" Meaning in life in the Federal Republic of Germany: results of a representative survey with the Schedule for Meaning in Life Evaluation (SMiLE)" ppt
Ngày tải lên :
20/06/2014, 16:20
... individual MiL in a representative sample of the German population to gather data for future comparisons with cancer and palliative care patients More specifically, the study aimed (i) to evaluate ... significantly higher levels of family life satisfaction and community satisfaction [35] Inhabitants of the affluent German South-West (BadenWuerttemberg, Bavaria, Hesse/Rhineland-Palatinate/Saarland, ... Development of the idiographic functional status assessment: a measure of the personal goals and goal attainment activities of people with AIDS Psychology and Health 1994, 9:111-129 O'Boyle CA: Making...
- 8
- 382
- 0
Báo cáo lâm nghiệp: "Variations in growth and virulence of Leptographium wingfieldii Morelet, a fungus associated with the bark beetle Tomicus piniperda L" pot
Ngày tải lên :
08/08/2014, 01:22
... trees after attacks by T piniperda have succeeded [13, 14] The mycobiota associated with a given bark beetle species can show considerable variations between localities and years and may be related ... containing 20 ml of malt agar (VWR International) medium (3% malt, 1.6% agar) At each temperature, replicates were used for each isolate, and the growth was recorded each day during days by the ... corresponding paper areas Percentages of blue stained sapwood area and healthy sapwood area were computed Each tree was characterized by the average values of its disks For the percentage of killed...
- 9
- 308
- 0
Báo cáo y học: "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" pptx
Ngày tải lên :
09/08/2014, 20:21
... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nishida H, Yap CC, ... genome Altogether, miRTRAP generated an apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19% To systematically compare the miRTRAP and miRDeep methods, ... features of Ciona microRNA biogenesis pathways The basic mechanisms of miRNA biogenesis are conserved across animals and plants [10,44], and the application of these rules is critical for the accurate...
- 12
- 552
- 0
Báo cáo khoa hoc:" The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton" pdf
Ngày tải lên :
11/08/2014, 07:21
... DAE staining was confined to the basal surface Page of of the plasma membrane (Figure 4A& 4H) In contrast, α spectrin was abundant at lateral sites of cell-cell contact as well as at the basal ... regulation of AE2 and AE3, but not AE1 [24] The R' sequence was nearly identical between AE2 and AE3, DAE was 80% identical to AE2 in this region, and AE1 was 53% identical to AE2 The other conserved ... further analysis because of its well-known interaction with ankyrin in mammals The anion exchanger belongs to a family of closely related genes (AE1, AE2 and AE3; also known as SLC 4A1 -3) and to a larger...
- 9
- 234
- 0
Báo cáo y học: "A neurotropic herpesvirus infecting the gastropod, abalone, shares ancestry with oyster herpesvirus and a herpesvirus associated with the amphioxus genome" pps
Ngày tải lên :
12/08/2014, 02:20
... Herpesviridae and now the Malacoherpesviridae families The rooting of a neurotropic invertebrate virus near or before the divergence of alpha-, beta-, and gammaherpesviruses, may also suggest that early ... Hardy-Smith P, Handlinger J: Ganglioneuritis causing high mortalities in farmed Australian abalone (Haliotis laevigata and Haliotis rubra) Australian Veterinary Journal 2007, 85:188-193 NACA: ... [8], and the Herpesviridae are clustered into separate major clades reflecting their taxonomic groupings of alpha-, beta- and gammaherpesvirinae sub-families The phylogenetic analysis confirms a...
- 9
- 261
- 0
Báo cáo khoa học: " eal-time ultrasound-guided catheterisation of the internal jugular vein: a prospective comparison with the landmark technique in critical care patients" pot
Ngày tải lên :
13/08/2014, 03:20
... between the sternal and clavicular head of the sternocleidomastoid muscle was degreased with acetone and prepared in a sterile fashion with povidone-iodine Then, the area was anaesthetised with a 1% ... avoid the carotid artery in these cases, a sideway approach of puncturing the IJV was used instead of the perpendicular approach It is of note that the most favourable outcomes associated with ... failure to gain access due to trauma or other anatomical anomalies, the IJV on the contralateral side was catheterised Catheterisation was performed under continuous dynamic observation of real-time...
- 8
- 554
- 0
english compound nouns in a contrastive analysis with the vietnamese equivalents and some implications for teaching and learning vocabulary in the textbook english for the hotel and tourist industry
Ngày tải lên :
02/03/2015, 14:29
... example, instead of using tea making machine and shoemaker they put them as tea make machine or make tea machine and shoe make This may also due to the interference from Vietnamese as in Vietnamese ... office manager is the manager of an office However, there are many cases where the meaning of the compound noun is a generalization instead of specialization It is in the case of coordinative and ... after, or in the middle of the stem The affixes that go before the root are called prefixes The ones that go after the root are referred to as suffixes And the affixes that go in the middle are...
- 51
- 3.1K
- 10
Báo cáo khoa học: A region within the C-terminal domain of Ure2p is shown to interact with the molecular chaperone Ssa1p by the use of cross-linkers and mass spectrometry doc
Ngày tải lên :
15/03/2014, 00:20
... mode An external calibration was performed using standard peptide solution Cal Mix1 and Cal Mix2 (Applied Biosystems) and an additional internal calibration was performed during mass spectra analysis ... candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually 10 Acknowledgements 11 We are grateful to Luc Bousset for designing a program ... information The following supplementary material is available: Fig S1 Analytical strategy for Ure2p–Ssa1p chemical cross-linking, cleavage and identification of the reaction products Fig S2 Primary...
- 12
- 510
- 0
HYGIENIC PHYSIOLOGY WITH SPECIAL REFERENCE TO THE USE OF ALCOHOLIC DRINKS AND NARCOTICS BEING A REVISED EDITION OF THE FOURTEEN WEEKS IN HUMAN PHYSIOLOGY ppt
Ngày tải lên :
15/03/2014, 13:20
... it, the vital organs are carried without fear of harm FIG [Illustration: B, _the first cervical vertebra, the atlas;_ A, _the atlas, and the second cervical vertebra, the axis;_ e, _the odontoid ... together, without being weary."] The muscles are nearly all arranged in pairs, each with its antagonist, so that, as they contract and expand alternately, the bone to which they are attached is ... the hand (Fig 1) The several parts are the _tarsus_, the _metatarsus_, and the _phalanges_ The graceful arch of the foot, and the numerous bones joined by cartilages, give an elasticity to the...
- 532
- 562
- 0
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
Ngày tải lên :
23/03/2014, 13:20
... cycle starts with the transfer of the carboxyl group from oxaloacetate to the prosthetic biotin group The carboxyltransfer reaction is catalysed at low rates by the a- subunit alone and with about ... of the oxaloacetate decarboxylase c-subunits from K pneumoniae and V cholerae The sequences of the c-subunits of the oxaloacetate decarboxylases from K pneumoniae and V cholerae are compared They ... c¢-2 and the 151 C-terminal amino acids of a- 2 was made The oligonucleotide primers used to generate appropriate DNA fragments are summarized in the Supplementary material In a first PCR run the...
- 10
- 333
- 0
Báo cáo y học: "A case study evaluating the use of clozapine in depression with psychotic feature" docx
Ngày tải lên :
08/08/2014, 21:20
... of clozapine was rather limited The approach allows clinicians to use relatively weak evidence with other clinical skills It necessitates the use of innovative practice at times, and enables clinicians ... She had worsening suicidal ideation On 19/8/01 the patient became very agitated and started lashing out Several staff members were needed to restrain her and she was sedated with IM lorazepam The ... decreased, ECT treatment was stopped and clozapine was started on the 28/9/01, and gradually titrated upwards monitoring her mental state and side effects A BPRS rating scale performed four days...
- 6
- 495
- 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc
Ngày tải lên :
09/08/2014, 04:21
... years, and a half-sister (from the paternal side) died of bronchioloalveolar carcinoma at the age of 25 years The patient's grandparents died of different causes, but none had cancer These data ... histological features of lobular carcinoma and infiltrating ductal carcinoma The family history suggested LFS: the patient's father was diagnosed with dorsal soft tissue leiomyosarcoma at the age of ... possibly clinical management Patients and Methods Family The family studied is of Mexican origin The index case was a 23-year-old female diagnosed with breast carcinoma of the left breast with combined...
- 7
- 403
- 0
Báo cáo y học: " A promoter haplotype of the interleukin-18 gene is associated with juvenile idiopathic arthritis in the Japanese population" pps
Ngày tải lên :
09/08/2014, 07:20
... FAM-TTTTGGTATCCCTCTCC-MGB SNP11F ACAGGTTTTGGAAGGCACAGA SNP11 VIC- ACGGAAGAAAAGATTT-MGB SNP11R AATAAAGTGGCAGAGGATACGAGTACT SNP11 FAM-ACGGAAGAAAACATTT-MGB SNP12F AATTGTCTCCCAGTGCATTTTGC SNP12 allele1 ... allele1VIC-TGAAGACCCTGGGC-MGB SNP6R CCCGAAGTCCGAGCACC SNP6 allele2 FAM-TGAAGACCCCGGGC-MGB SNP9F GAAAGTTTTAACACTGGAAACTGCAA SNP9 allele1 VIC-TTTTGGTAGCCCTCTC-MGB SNP9R TTACACTTTCTGCAACAGAAAGTAAGC SNP9 allele2 ... FAM- CGAAGATAGAAGAATC-MGB SNP5F AAGCTGAGGCAGGAAGATCAC SNP5 allele1 VIC- TCGGGAGTTCGAGACC-MGB SNP5R ACACAGGGTTTCACCATGCT SNP5 allele2 FAM- CGGGAGTTGGAGACC-MGB SNP6F TCCCTACTGTTGTTTCCGCC SNP6 allele1VIC-TGAAGACCCTGGGC-MGB...
- 9
- 559
- 0
Báo cáo y học: ": Revision of a nonunited subtrochanteric femoral fracture around a failed intramedullary nail with the use of RIA products, BM" pps
Ngày tải lên :
11/08/2014, 00:22
... femoral fracture around a failed intramedullary nail with the use of RIA products, BMP-7 and hydroxyapatite: a case report Christopher Tzioupis1, Pavlos Panteliadis1, Zakareya Gamie1, Eleftherios ... Case presentation An 80-year-old Caucasian woman sustained a right subtrochanteric femoral fracture following a domestic fall, classified according to the AO Foundation (AO)/Orthopaedic Trauma ... reduction and stabilization of the fracture with a trochanteric gamma nail (TGN) callus formation Subsequent radiographs obtained at four and six months revealed delayed union; therefore, the nail was...
- 7
- 456
- 0
Báo cáo y học: "Co-existence of a giant splenic hemangioma and multiple hepatic hemangiomas and the potential association with the use of oral contraceptives: a case report" potx
Ngày tải lên :
11/08/2014, 23:21
... digital angiography in the accurate diagnosis of hemangiomas Tarazov et al [8] and Yamamoto et al [4] highlight the efficacy of angiography and arterial embolism in the diagnosis and treatment ... of hemangiomas The MRI appearance of splenic hemangiomas has been described as being similar to that of hepatic hemangiomas However, larger hemangiomas may have a variable MRI pattern because of ... Walter J, Orlow SJ, Marchuk DA: Familial segregation of hemangiomas and vascular malformations as an autosomal dominant trait Arch Dermatol 1998, 134:718-722 Meera AV, Sen S, Raghupathy P, Walter...
- 5
- 384
- 0
báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps
Ngày tải lên :
12/08/2014, 00:20
... patients with RA The results of this review provide a comprehensive assessment of the available evidence for the utility of available scales for patients with RA and may inform the appropriate ... was given if an adequate external indicator was used to categorize patients according to change status, the indicators were adequately described, and the relationship of the indicator with the ... functional capacity, since it cannot measure improvement in a substantial proportion of patients Both the MDHAQ (14 ADL) and the HAQ-II were rated favorably for all aspects of validity as well and...
- 13
- 384
- 0
Báo cáo y học: " A promoter SNP rs4073TA in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode" docx
Ngày tải lên :
12/08/2014, 13:22
... chi-square (MHC) tests were used to test for trend in the categorical analysis The data were managed and analyzed using SAS version 9.1 (SAS Inc., Cary, NC, USA) Statistical power of single associations ... Luciferase Assay System and luminometer (VICTOR3, Perkinelmer, Waltham, MA, USA) And the relative luciferase activity was normalized to the protein concentration and b-galactosidase activity Statistics ... luciferase activity was adjusted by pGL3 basic vector, and the yield of DNA transfection adjusted using pSV-b-galactosidase (+) vector and ONPG activity The luciferase activity of the rs4073T >A TT allele...
- 7
- 284
- 0
Báo cáo khoa học: " A Process monitoring in intensive care with the use of cumulative expected minus observed mortality and risk-adjusted p charts" ppt
Ngày tải lên :
12/08/2014, 23:21
... Raton, FL, USA) The ICNARC data subset was then extracted from this with a specially developed database program (Wardwatcher; Critical Audit, London, UK) All data were verified by a trained data ... the optimal detection of changes with an acceptable false alarm rate, and they can be difficult to explain to managers, clinicians and non-statisticians The purpose of this paper is to evaluate ... We have used the data collected for central analysis, and analysed it in a way that provided local formative ICU assessment of mortality rate performance This approach poses little additional...
- 9
- 305
- 0