Ngày tải lên: 06/07/2014, 15:37
Ngày tải lên: 12/08/2014, 12:20
Employee Engagement: A Driver of Organizational Effectiveness
Ngày tải lên: 07/09/2013, 11:05
Tài liệu Installing a Driver ppt
... For example, a new sound card will most likely not work, or will work improperly. If the wrong drivers are installed. Also, using the latest driver is a good practice to follow. When installing ... installing a new device, check the manufacturer’s web site for the latest drivers available for their product. If there are problems with the mouse pointer, verify that it is properly connected and ... is clean and free of any dust or debris. If the problem still exists after verifying the connection and cleaning, try restarting the machine. Rebooting the machine will refresh and reload the...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx
... planning specification language and show how LTAG grammaticality can be encoded as a PDDL problem and how we can reconstruct an LTAG derivation from the plan. 2.1 Tree-adjoining grammars The grammar ... filled); an auxiliary tree has an effect ơmustadjoin (A, u) to indicate that any oblig- atory adjunction constraint is satisfied but leaves the canadjoin condition in place to allow multiple ad- junctions ... changed by the action. Atoms are printed in boldface iff they contradict the goal. This plan can be read as a derivation tree that has one node for each action instance in the plan, and an edge from...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot
... 5720–5728. 12 Gao J, Katagiri H, Ishigaki Y, Yamada T, Ogihara T, Imai J, Uno K, Hasegawa Y, Kanzaki M, Yamamoto TT et al. (2007) Involvement of apolipoprotein E in excess fat accumulation and insulin ... steady-state plasma FFA levels, our apoE ) ⁄ ) mice were resistant to diet-induced NAFLD and obesity. Thus, our data do not support the notion that elevated plasma FFAs are pivotal for the accumu- lation ... showed heavy loading with fat. The reticulin stain is a classical histopathological mar- ker for the identification of hepatic architecture and structural damage within the liver parenchyma. There- fore,...
Ngày tải lên: 05/03/2014, 23:20
Báo cáo "Algorithm for solution of a routing problem " pot
... A and B. Example 3. Find an optimal tour for Problem A and B with the following input data (the source a 4 and the sink a 11 for Problem A) : vertices a 1 a 2 a 3 a 4 a 5 a 6 a 7 a 8 ... Consider a complete graph G = (A, E) with vertex set A = {a 1 , a 2 , … , a n } and edge set E = A A. Each vertex a i A has a real number t i (i = 1, … , n), called the altitude of vertex a i . ... that a 4 ↔ 6, a 11 ↔ 12, so we have b = 6 and e = 12. vertices a 9 a 2 a 5 a 12 a 15 a 4 a 3 a 6 a 7 a 1 a 8 a 11 a 14 a 17 a 13 a 10 a 16 altitude 1 3 3 4 4 5 8 8 8 9 9 11...
Ngày tải lên: 14/03/2014, 13:20
Episode 3 Hector has a date pot
... Hector Has a Date 8 Episode 3 Narrative ANNIE [sending email] ‘Dear dream date. My name is Annie! I’m 19 and I love animals, and, and – and I love chocolate: chocolate ice cream, chocolate cake, ... Nick, what about Bridget and Annie? NICK Aha! It’s not a problem! HECTOR [Laughs] Ah-ha-ha! Yes! ANNIE [sending email] ‘Nadia, it’s terrible news. Hector killed my plant with perfume!’ ANNIE Oh, ... million-aire? HECTOR Psst, psst! Am I a millionaire? NICK [Laughs] Are you a millionaire? Are you a millionaire? [Laughs] Ha! We are millionaires! BRIDGET and ANNIE Good – good. BRIDGET Well you can...
Ngày tải lên: 15/03/2014, 17:20
Báo cáo khoa học: The HS:19 serostrain of Campylobacter jejuni has a hyaluronic acid-type capsular polysaccharide with a nonstoichiometric sorbose branch and O-methyl phosphoramidate group docx
... AE, Goldberg JB & Dicesare TJ (1991) Hyaluronic acid capsule is a virulence factor for mucoid group A streptococci. Proc Natl Acad Sci USA 88, 8317–8321. 49 Kawabata S, Kuwata H, Nakagawa ... Szymanski and Jean-Robert Brisson Institute for Biological Sciences, National Research Council of Canada, Ottawa Ontario, Canada Campylobacter jejuni is one of the leading causes of human gastroenteritis ... HS:19 serostrain and have shown that these labile groups are an a- l-sorbofuranose branch attached at C2 of b-d-GlcA and a MeOPN modifica- tion located at C4 of b-d-GlcNAc. There are very few reports...
Ngày tải lên: 16/03/2014, 13:20
Phục hồi USB với HP USB Disk Storage Format Tool pot
... ta mở Command Prompt. Nếu bạn đang dùng Vista bạn vào nên chạy nó như Run as administrator bằng cách vào Start/Programs/Accessories và click chuột phải lên Command Prompt chọn dòng Run as administrator. ... vậy là ổ USB sẽ có khả năng tự động được boot sau khi khởi động máy tính. HP USB Disk Storage Format Tool Cứu sống USB sắp chết Khi download HP USB Disk Storage Format Tool và cắm USB vào ... Phục hồi USB với HP USB Disk Storage Format Tool Sử dụng HP USB Disk Storage Format Toollà những lúc bạn cần 1 công cụ format USB thật mạnh bởi vì chức năng format có sẵn c a Windows quá...
Ngày tải lên: 20/03/2014, 23:20
Báo cáo khoa học: Saccharomyces cerevisiae a1,6-mannosyltransferase has a catalytic potential to transfer a second mannose molecule ppt
... (5Â-CAAGAGGTGGTATTTACTCAGCTATGGATA CTATGCTTTTGAA-3Â) and D18 8A- RV (5Â-TTCAAAAGC ATAGTATCCATAGCTGAGTAAATACCACCTCTTG-3Â), and the pPICZaA-ScOCH1 as a template. The both D18 8A mutant and wild-type proteins were expressed as mentioned above. After ... putative transmembrane region was amplified by PCR with two primers, OCH1-FW (5Â- CTCGAGAAAAGACACTTGTC AAACAAAAGGCTGCTT-3Â; the XhoI site is underlined) and OCH1-RV (5Â- TCTAGACGTTTATGACCTGCATTT TTATCAGCA-3Â; ... Ala, we used QuickChange II Site-directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) by using two mutagenic primers, which were D18 8A- FW (5Â-CAAGAGGTGGTATTTACTCAGCTATGGATA CTATGCTTTTGAA-3Â)...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo Y học: Human bile salt-stimulated lipase has a high frequency of size variation due to a hypervariable region in exon 11 pot
... ost common variant. An onco-fetal variant of BSSL, d enoted feto-acinar pancreatic p rotein (FAPP), has been d etected in human embryonic and fetal pancreas and in pancreatic tumoral cell lines ... signals visualized using a Molecular I mager (Bio-Rad L aboratories, Hercules, CA). 32 P-Labelled k HindIII digested DNA was used as molecular mass standard on the R NA gels. DNA isolation and Southern ... differing in apparent molecular mass, have been described in human milk [27±29]. V ariants of h igher, as well as lower, molecular mass than the most common 120-kDa variant were detected. Occasionally,...
Ngày tải lên: 24/03/2014, 03:21
The girl who looks like Taylor has a fair complexion potx
... chia là “looks”. Cấu trúc “look like” = “to be like” – giống như, như. - “The girl … .has a fair complexion” – cô gái ….có (một) làn da trắng. a fair complexion” = a fair skin” – làn da đẹp, ... girl who looks like Taylor has a fair complexion. 2. Các bạn hãy di chuột vào từng cụm từ một để biết chức năng c a cụm trong câu: The girl who looks like Taylor has a fair complexion. ... làn da đẹp, da trắng. Cụm từ có ngh a ngược là a *The girl who looks like Taylor has a fair complexion. Hình thức cấu trúc ngữ pháp: Mệnh đề quan hệ xác định với đại từ quan hệ “who”....
Ngày tải lên: 25/03/2014, 03:21
Báo cáo khoa học: The Thermoplasma acidophilum Lon protease has a Ser-Lys dyad active site pot
... Â-CCGGTTGGCGGCGTAAC CGCA GCGGTTGAGGCAGCTATAGAAGC-3Â (sense), 5Â-GCTTCTATAGCTGCCTCAAC CGCTGCGGTTAC GCCGCCAACCGG-3Â (antisense); K7 2 2A, 5Â-GCCGA TGGTGGTTTGAAAGAA GCCCTCCTGGCAGCGCA TCGCG -3Â (sense), 5Â-CGCGATGCGCTGCCAGGAG GGCTTCTTTCAAACCACCGATCGGC-3Â ... encompasses an N-terminal ATPase associated with various cellular a ctivities ( AAA + domain) and a C-terminal protease domain, but lacks the N-terminal a- helical domain inherent in most bacterial ... individually muta ted to alanine (S52 5A and K56 8A) . As with TaLonwt, the S -K mutants were purified as hexamers (data not shown) sustaining substantial ATPase activity (Table 1), but no peptidase activity...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: The HS:1 serostrain of Campylobacter jejuni has a complex teichoic acid-like capsular polysaccharide with nonstoichiometric fructofuranose branches and O-methyl phosphoramidate groups pot
... J, Wang Y, Krueger WA, Madoff LC, Marti- rosian G, Boisot S, Goldmann DA, Kasper DL, Tziana- bos AO & Pier GB (1999) Isolation and chemical characterization of a capsular polysaccharide antigen shared ... fructose branch at Gal C-2 was present and; another at 5.20 p.p.m. when it was absent. These structural artifacts complicated NMR and mass spectrometry data and as a result, hindered the identification ... Ontario, Canada The Gram-negative, spiral-shaped bacterium Campylo- bacter jejuni is one of the leading causative agents of human enteritis and surpasses Salmonella, Shigella and Escherichia in some...
Ngày tải lên: 30/03/2014, 20:20
Chapter 12 Mass - Storage Systems
... OS jobs are to manage physical devices and to present a virtual machine abstraction to applications ■ For hard disks, the OS provides two abstraction: ● Raw device – an array of data blocks. ● File ... second. ● Sustained bandwidth – average data rate during a large transfer; # of bytes/transfer time. Data rate when the data stream is actually flowing. ● Effective bandwidth – average over the entire ... magnetic tape if only one tape is used per drive. ■ The cheapest tape drives and the cheapest disk drives have had about the same storage capacity over the years. ■ Tertiary storage gives a...
Ngày tải lên: 13/05/2014, 00:36
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc
... Nowak 2 , Rolf Merget 3 , Catherine Lemiere 4 and Xaver Baur 1 Abstract Background: Isocyanates are some of the leading occupational causes of respiratory disorders, predominantly asthma. Adequate ... material Additional file 1: Materials. Additional file 2: Supplementary data to the methods. Additional file 3: Validation data to the GC-MS-method. Additional file 4: Examples of individual patient ... Becker A, Boulet LP, Bowie D, Cartier A, Cave A, Chapman K, et al: Adult Asthma Consensus Guidelines update 2003. Can Respir J 2004, 11(Suppl A) : 9A- 1 8A. 19. Baur X, Marek W, Ammon J, Czuppon AB, Marczynski...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Mass spectrometry based on a coupled Cooperpair box and nanomechanical resonator system" pdf
... K, Zettl A: An atomic-resolution nanomechanical mass sensor. Nat Nanotechnol 2008, 3:533. 7. Naik AK, Hanay MS, Hiebert WK, Feng XL, Roukes ML: Towards single- molecule nanomechanical mass spectrometry. ... Cooper- pair box and nanomechanical resonator system Cheng Jiang, Bin Chen, Jin-Jin Li and Ka-Di Zhu * Abstract Nanomechanical resonators (NRs) with very high frequency have a great potential for mass ... this article as: Jiang et al.: Mass spectrometry based on a coupled Cooper-pair box and nanomechanical resonator system. Nanoscale Research Letters 2011 6:570. Submit your manuscript to a journal...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " European Union and German law on coexistence: Individualisation of a systemic problem" docx
Ngày tải lên: 21/06/2014, 01:20