upon derecognition disposal or cancellation of an asset or liability associated with an exchange gain with a debit to account 821
báo cáo hóa học:" The prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer" docx
Ngày tải lên :
20/06/2014, 07:20
... receptors or ligands have been reported to be associated with outcome in patients with ovarian cancer In a study by Conner and Felder the inhibitory effect of ovarian cancer ascites was associated ... therapy, at least in part, due to the action of anti-apoptotic factors and /or growth factors in ascites that favour tumor cells to re-populate causing tumor relapse Our data emphasize the need to ... prosurvival activity of ascites against TRAIL is associated with a shorter disease-free interval in patients with ovarian cancer Journal of Ovarian Research 2010 3:1 Publish with Bio Med Central and...
- 10
- 383
- 0
Tài liệu Characterization of the Polymorphic Behavior of an Organic Compound Using a Dynamic Thermal and X-ray Powder Diffraction Technique pptx
Ngày tải lên :
14/02/2014, 03:20
... TGA analysis was performed on several samples using a TA 2950 TGA with a platinum pan A nitrogen atmosphere was used for each trial Some analyses were performed on a Perkin Elmer-7 TGA with an ... Figures and 9) The lack of any additional peaks in the XRPD patterns would imply the presence of an Figure DSC of atypical anhydrous Form I (sample 11) amorphous material and /or an impurity Note that ... Evolved Gas Analysis Simultaneous TG/MS and TG/gas chromatography (GC)/MS analysis were performed on several samples A split was used to send a fraction of the evolved gases to a quadruple mass spectrometer...
- 16
- 549
- 0
Báo cáo sinh học: " Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" pptx
Ngày tải lên :
19/06/2014, 08:20
... KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested with NcoI and XhoI, and cloned into the pTM1 vector, yielding pTM-P 4a which ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and ... residue mutated to an alanine (pI7LH24 1A) The extracts are prepared as described in the Materials and Methods The extracts are mixed and incubated with the substrates for hrs and then analyzed through...
- 8
- 481
- 0
Báo cáo hóa học: " An antigenic epitope of influenza virus nucleoprotein (NP) associated with polymeric forms of NP" ppt
Ngày tải lên :
20/06/2014, 01:20
... manuscript All authors have read and approved the manuscript Acknowledgements We are grateful to Professor N.V Kaverin (the D.I Ivanovsky Institute of Virology, Russia) and to Professor O Planz ... experimental work and to data interpretation VC assisted the experiments as well as data analysis LS coordinated the research efforts, provided with polyclonal and monoclonal antibodies and revised ... non-concentrated m-NP before RIPA (lane 1) and after immunosorption by RIPA using mAb N5D3 (lane 2) The concentrated soluble self -associated m-NP (as described in the text) before RIPA (lane 3) and after...
- 5
- 385
- 0
báo cáo hóa học:" Development of an in vitro cleavage assay system to examine vaccinia virus I7L cysteine proteinase activity" docx
Ngày tải lên :
20/06/2014, 04:20
... KH10 (5' CATGCCATGGATGATGCCTATTAAGTCAATAGTTACT CTT-3') and KH11 (5'-CCGCTCGAGTTATTCATCATCAAAAGAGACAGAGTC-3'), digested with NcoI and XhoI, and cloned into the pTM1 vector, yielding pTM-P 4a which ... the lack of essential co-factors or inappropriate assay conditions As an alternative approach, we sought to develop a cleavage assay using infected cell extracts as the source of I7L activity and ... residue mutated to an alanine (pI7LH24 1A) The extracts are prepared as described in the Materials and Methods The extracts are mixed and incubated with the substrates for hrs and then analyzed through...
- 8
- 336
- 0
Science Report: "Determining the value of an exchange energy of corn as feed for chickens by direct methods" pps
Ngày tải lên :
06/08/2014, 18:22
... A. A., Figuerelo A. N., Racanicci A. M.C., Gaiotto J.B and Sorbara J.O.B.(2004) Determination of the energetic value of corn, soybean and micron zed full fat soybean for newly hatched chicks Brazilian ... and sons - New Yord, USA 52 Farrell, D J., (1983) Feeding Standards for Australian Livestock – Poultry – SCA Technical Report Series – No 12, Canberra McDonald P., J.F.D Greenhalgh and C .A Morgan ... Requirement of Swine National Academy press Washington D.C Keith Smith (1991) Advances in feeding soybean meal Keith Smith and Associates 15 Winchester road, Farmington, MO 63640, Soybean Meal Inforsouce...
- 7
- 285
- 0
Báo cáo lâm nghiệp: "Earthworms (Lumbricidae) of an air-polluted area affected by ameliorative liming" pdf
Ngày tải lên :
07/08/2014, 10:21
... Soil characteristics (exchangeable pHKCl , total carbon and nitrogen, exchangeable soil sorption and degree of base saturation of the sorption complex and available nutrients P, Mg, K and Ca) were ... for monitored stands in the H and Ah horizons (see in detail M, K 2011) For statistical evaluation a single-factor analysis ANOVA was used and Tukey’s test was used for the detection of ... individuals·m–2) A partial shift according to abundance was indicated towards higher pH in D octaedra (Table 4) The high level of the sorption capacity of soil (T) was dominant Because comparative categories...
- 9
- 409
- 0
Báo cáo lâm nghiệp: "Evolution of the mineral fertility of an acidic soil during a period of ten years in the Vosges mountains (France). Impact of humus mineralisation" pps
Ngày tải lên :
08/08/2014, 00:21
... for mineral soil analyses, to the INRA laboratory in Bordeaux (L.E.R.M .A. V.E.) for organic horizon analyses; to Jacques Ranger for reading, criticizing and improving this paper and to Geraldine ... balance was positive to varying degrees for Ca, Mg and K For K, the actual balance (soil analysis) was in the calculated interval, but, for Ca, there was a loss of 9.7 kg·ha–1 instead of a gain ... 0.18 Exchangeable Ca Exchangeable Mg 0.20 0.34 Exchangeable K 0.18 0.22 Exchangeable Mn 0.16 0.55 Exchangeable Fe 0.04 0.13 Exchangeable Al 7.55 6.60 Bioavailable P2O5 (extracted by 2% citric acid)...
- 8
- 334
- 0
Báo cáo khoa học: "Consequences of an excess Al and a deficiency in Ca and Mg for stomatal functioning and net carbon assimilation of beech leaves" ppt
Ngày tải lên :
08/08/2014, 14:22
... between +Al (–31%) and –CaMg (–43%) treatments An interaction between excess Al and a deficiency in Ca and Mg was calculated for +Al–CaMg plants (–70%) The decrease in A was accompanied by a constancy ... changes in stomatal conductance Stomatal conductance to water vapor (g w ) was monitored by means of a diffusive porometer (Delta-T-Devices, Cambridge, UK) under darkness (measured at predawn), ... enhanced transpiration rates of spruce needles due to Al The impact of Al on plant water balance appears to be complex, and therefore requires further investigations Although the mechanism of Al...
- 10
- 376
- 0
Báo cáo y học: " Psychological distress among patients of an orthopaedic outpatient clinic: a study from a low-income country" docx
Ngày tải lên :
08/08/2014, 23:21
... entered and analysed on SPSS version 14.0 (SPSS, Chicago, IL, USA) In order to assess the variables that were significantly associated with SRQ scores we used analysis of variance (ANOVA) for ordinal ... be significantly associated with SRQ score were then added as covariates in an analysis of covariance (ANCOVA), which examined the relationship between orthopaedic diagnosis and SRQ score Post ... Questionnaire (SRQ) scores by orthopaedic diagnosis adjusted for age, sex, years of education, marital status, number of children and income Diagnosis Adjusted mean Standard error of the mean Major...
- 7
- 278
- 0
Báo cáo y học: "Identification of a SmD3 epitope with a single symmetrical dimethylation of an arginine residue as a specific target of a subpopulation of anti-Sm antibodies" ppsx
Ngày tải lên :
09/08/2014, 06:22
... (SMP) assay (a) Intra-assay and interassay variability, (b) linearity, and (c) receiver operating characteristic analysis The intra-assay and interassay variability, expressed as coefficient of variation ... 40:413-418 29 James K, Carpenter AB, Cook L, Marchand R, Nakamura RM: Development of the antinuclear and anticytoplasmic antibody consensus panel by the Association of Medical Laboratory Immunologists ... Diagnostics) Assay performance characteristics To evaluate the performance of the assay, the precision, reproducibility and linearity were analyzed The intra-assay and interassay variabilities (coefficient...
- 11
- 593
- 0
Báo cáo y học: " Spontaneous bleeding of an Abrikossoff''''s tumor - a case report." pps
Ngày tải lên :
10/08/2014, 10:20
... author of the manuscript, AW was the initial doctor in charge, CB is the pathologist, BL performed the lobectomy as head of surgical department All authors have read and approved the final version ... than mm in diameter Bronchoscopical treatment of larger tumors is associated with a significant increase in the recurrence rate In addition, the hemorrhage rate is also increased [12,13] Our patient ... Sutedja TG, Kwa HB, Postmus PE, Wagenaar SS: Granular cell tumors of the tracheobronchial tree J Thorac Cardiovasc Surg 2003, 126(3):740-3 Valenstein SL, Thurer RJ: Granular cell myoblastoma of...
- 3
- 425
- 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
Ngày tải lên :
11/08/2014, 00:23
... amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply ... Ishikawa diagrams to facilitate problem-based learning when teaching medical students and junior doctors Starting with a clinical vignette, facilitators can help medical students and junior doctors ... diagram The Ishikawa diagram can then be kept by individual learners for continual updating when they acquire new or relevant information In short, an Ishikawa diagram can assist memory and the...
- 3
- 381
- 0
báo cáo khoa học: " Lower respiratory tract infection and rapid expansion of an abdominal aortic aneurysm: a case report" pot
Ngày tải lên :
11/08/2014, 02:21
... assessment with an abdominal ultrasound for AAAs greater than cm [8] In small AAAs with a size of 3.0 to 3.9 cm growth, the growth rate has been reported as an average 0.11 cm annually [2] AAAs ... position and patency Discussion The expansion rate of AAAs varies according to numerous factors The probability of rupture of a cm and cm AAA is less than 16% and 25% per year, respectively [7] and ... this article as: Naylor et al.: Lower respiratory tract infection and rapid expansion of an abdominal aortic aneurysm: a case report Journal of Medical Case Reports 2010 4:333 Submit your next manuscript...
- 4
- 351
- 0
báo cáo khoa học: " Paradoxical embolism following thromboaspiration of an arteriovenous fistula thrombosis: a case report" pot
Ngày tải lên :
11/08/2014, 02:21
... (CT) scan of the abdomen revealed a perigraft hematoma Three days later (on day 25), she developed thrombosis of her AV fistula Anticoagulation treatment with danaparoid sodium (Orgaran) was reinitiated ... DD, KD and BA managed the patient in their respective departments and contribute to the preparation of this case report PL is the supervisor of the management and DS has managed the patient and ... Page of Figure Transesophageal echocardiography A patent foramen ovale (PFO) with a left -to- right shunt is shown at the level of the interatrial septum RA and LA indicate right and left atria...
- 5
- 373
- 0
báo cáo khoa học: "Posterior leukoencephalopathy following repair of an ileocecal anastomosis breakdown: a case report and review of the literature" ppsx
Ngày tải lên :
11/08/2014, 03:20
... Patricia Donohoe and Dr Paul Chapman for their critical reviews of this manuscript The authors also thank the patient for agreeing to the publication of this case report Author details Department of ... report the case of a 22-year-old Caucasian man with a 10-year history of Crohn’s disease He had recently undergone a small bowel resection and ileocecal anastomosis On his fourth post-operative ... report, Triquenot-Bagan et al reported the case of a 55-year-old man who was operated on for an abdominal Zinn et al Journal of Medical Case Reports 2011, 5:20 http://www.jmedicalcasereports.com/content/5/1/20...
- 3
- 347
- 0
Báo cáo y học: " Axillary nodal metastasis at primary presentation of an oropharyngeal primary carcinoma: a case report and review of the literature" ppt
Ngày tải lên :
11/08/2014, 17:21
... Rayatt SS, Dancey AL, Fagan J, Srivastava S: Axillary metastases from recurrent oral carcinoma Br J Oral Maxillofac Surg 2004, 42:264-266 Oo AL, Yamguchi S, Iwaki H, Amagasa T: Axillary nodal ... final manuscript Do you have a case to share? Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach ... drafting of the manuscript and critically revising it for important intellectual content BM managed the patient, obtaining all tissue samples and imaging BM was the first author JL read and approved...
- 3
- 276
- 0
báo cáo khoa học: " Upper eyelid reconstruction: a short report of an eyelid defect following a thermal burn" pdf
Ngày tải lên :
11/08/2014, 20:20
... vascularization since it contains branches of the angular artery and the infraorbital artery in its pedicle Making use of a muco-cartilaginous graft taken from the ala of the nose is also advantageous, ... edges, with a linear scar (hardly noticeable) on the temporal area The incision performed on the lower palpebral rim, necessary for the preparation of the orbicularis muscle as a myocutaneous temporal ... sutured to the levator palpebrae superioris aponeurosis and muscle On the other hand, to reconstruct the anterior lamella, which consists of skin A http://www.head-face-med.com/content/5/1/26 and...
- 3
- 209
- 0
Báo cáo y học: "Life-threatening biopsy of an iliopsoas pseudotumour in a patient with haemophilia: a case report" docx
Ngày tải lên :
11/08/2014, 23:21
... certainly indicated when haemophilia is considered Muscular bleeding is one of the most important manifestations of haemophilia, and it is important to carry out a detailed history to eliminate any underlying ... 19:255-260 Armas-Loughran B, Kalra R, Carson JL: Evaluation and management of anemia and bleeding disorders in surgical patients Med Clin North Am 2003, 87:229-242 Publish with Bio Med Central and every ... differentiating tumor, abscess, and hematoma AJR Am J Roentgenol 1994, 162:83-86 Sevilla J, Alvarez MT, Hernandez D, Canales M, De Bustos JG, Magallon M, Garzon G, Hernandez-Navarro F: Therapeutic...
- 4
- 293
- 0
Báo cáo y học: " Arterial embolization of an extrapleural hematoma from a dislocated fracture of the lumbar spine: a case report" potx
Ngày tải lên :
13/08/2014, 23:20
... method of management should be changed immediately, because embolization of the great anterior radicular artery can lead to spinal ischemia Abbreviations EH: extrapleural hematoma; AE: arterial embolization; ... significance of traumatic extrapleural hematoma J Trauma 2000, 49:286-290 Hagiwara A, Iwamoto S: Usefulness of transcatheter arterial embolization for intercostal arterial bleeding in a patient with ... accumulated in the thoracic cavity was because of an EH and not because of the hemothorax An angiography was immediately performed to restore hemostasis; a shepherd-hook catheter (4 F, CX catheter A2 ;...
- 5
- 199
- 0