uplift capacity of shallow foundations

Shallow foundations bearing capacity and settlement

Shallow foundations bearing capacity and settlement

... 23 24 Shallow Foundations: Bearing Capacity and Settlement 2.4 Meyerhof’s Bearing Capacity Theory In 1951, Meyerhof published a bearing capacity theory that could be applied to rough, shallow, ... Bearing Capacity 41 2.8 Effect of Water Table 44 2.9 General Bearing Capacity Equation 45 2.10 Effect of Soil Compressibility 50 2.11 Bearing Capacity of Foundations ... the ultimate bearing capacity of shallow foundations under various types of loading and subsoil conditions In this edition new details relating to the variation of the bearing capacity factor Ng...

Ngày tải lên: 03/04/2015, 23:41

344 252 0
The design of mat foundations

The design of mat foundations

... soil to the point of allowing for mat foundations and shallow footings instead of more traditional pile foundations Without the need for 60- to 80- foot piles, the shallow foundations also allowed ... movement of grains to reduce the volume Typically includes shallow subsidence May occur in sandy coastal plain area, sandy glacial deposits, and alluvial deposits of intermountain regions of the ... in some areas of the central and western United States Photograph of the construction of the mat foundation for the new Century Hotel in San Francisco (1999) Having had 25 feet of dredge spoils...

Ngày tải lên: 16/10/2012, 10:43

65 657 0
Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge

Effect of dissolved organic matter (DOM) and biofilm on the adsorption capacity of powdered activated carbon in activated sludge

... effect of biofilm on the adsorption capacity of PAC, PAC covered with biofilm was made and its adsorption capacity was compared to the adsorption capacity of new PAC repeated times For biofilm ... 3.3 Effect of biofilm on PAC on adsorption capacity of PAC Although the adsorption of DOM with molecular weight ranging from 50,000 to 300,000 Da decreased the adsorption capacity of PAC in the ... adsorption capacity of PAC decreased with incubation time In other word, the adsorption capacity of PAC increased with increase in the amount of organic carbon on PAC The adsorption capacity of PAC...

Ngày tải lên: 05/09/2013, 08:40

10 557 0
Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond

Seasonal Changes of Shallow Aquatic Ecosystems in a Bird Sanctuary Pond

... water The sum of the weight of each species during the surveillance period was calculated Then, the 10 species of cormorants, geese, swans, and ducks, accounted for more than 98% of TWW during ... Fig TN concentration of 3.0 mg/L was observed at the beginning of the study period, in term S3, and decreased Table - Total weight of each species and its ratio to the sum of TWW for 10 dominant ... weights of each species were the average of minimum and maximum weight data (Wild Bird Society of Japan, Ehime Branch, 1995; Higuchi et al., 1996) Species name Scientific name A sum of each species...

Ngày tải lên: 05/09/2013, 10:15

9 430 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... of CTD of /11 CI The ribbons, helices and tubes represent a-helices, b-sheets and loops, respectively (D) Schematic representation of NTD of /11 CI; notation as in (C) (E) Far-UV CD-spectra of ... masses (kDa) are shown to the right of the gel (B) Autoradiogram of the gel shift assay shows the binding of varying concentrations (0.2–2 lM) of CI to a fixed amount of O1 DNA mix ( 0.1 nM 32P-labeled...

Ngày tải lên: 07/03/2014, 00:20

11 432 0
Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

Báo cáo Y học: Differences in the binding capacity of human apolipoprotein E3 and E4 to size-fractionated lipid emulsions pot

... surface of lipid particles In the present study we develop methods for the characterization of lipid emulsions of well-defined composition but different particle size We compare the binding of apoE3 ... yielded individual fractions of particles with radii in the range of 38–52 nm Flotation velocity analysis of fractionated lipid emulsions The solution properties of the major emulsion fractions ... distribution of emulsion fraction in the absence and presence of apoE(263–286), calculated with a fixed diffusion coefficient of 0.46 · 10)7 cm2Ỉs)1 Relative to the control, the flotation rate of fraction...

Ngày tải lên: 08/03/2014, 09:20

11 600 0
Đề tài " An isoperimetric inequality for logarithmic capacity of polygons " potx

Đề tài " An isoperimetric inequality for logarithmic capacity of polygons " potx

... proof of Lemma in Section was suggested by one of the referees LOGARITHMIC CAPACITY OF POLYGONS 281 Logarithmic capacity and reduced module There are several other approaches to the measure of ... D = ∅, the base of T lies on ∂D (the base of T need not consist of an entire side of D), S ∩ D = ∅, and if each (closed) side (not base!) of S contains at least one vertex of D Of course, the ... logarithmic capacity, admits an explicit upper bound B given by a weighted sum of the reduced modules of triangles composing D, each of which has a distinguished vertex LOGARITHMIC CAPACITY OF POLYGONS...

Ngày tải lên: 14/03/2014, 22:20

28 217 0
Báo cáo khoa học: "A Suite of Shallow Processing Tools for Portuguese: LX-Suite" doc

Báo cáo khoa học: "A Suite of Shallow Processing Tools for Portuguese: LX-Suite" doc

... to 2% of the corpus that was used and any tokenization error will have a considerable negative influence on the subsequent steps of processing, such as POS tagging To resolve the issue of ambiguous ... training, we used 90% of a 280, 000 token corpus, accurately hand-tagged with a tagset of ca 60 tags, with inflectional feature values left aside Evaluation showed an accuracy of 96.87% for this ... processing of Portuguese is being developed under the Delphin initiative 10 In collaboration with CLUL,11 and under the TagShare project, LX-Suite is being used to help in the building of a corpus of...

Ngày tải lên: 17/03/2014, 22:20

4 270 0
Báo cáo khoa học: "THE RECOGNITION CAPACITY OF LOCAL SYNTACTIC CONSTRAINTS" ppt

Báo cáo khoa học: "THE RECOGNITION CAPACITY OF LOCAL SYNTACTIC CONSTRAINTS" ppt

... det det Note that for a sentence of length k, the power of LCA(k) is idcnticM to the weak generative capacity of the full underlying grammar But since the size of sentences (tag sequences) in ... refer to the set of lcxicaUy valid readings of a given word We use the term path to refer to a sequence of M tags ( M ~ N) which is a tagimage corresponding to the words W, , WN of a given sentence ... studies of modern written ! lebrew suggest that about 60% of the word-forms in running texts are ambiguous with respect to a basic tag set, and the :average number of possible readings of such...

Ngày tải lên: 18/03/2014, 02:20

6 305 0
Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... (including several SS isoforms) are capable of associating in a multisubunit complex, and that these interactions may be of physiological importance [13,14] One of the soluble SS isoforms, SSIII, has ... N-terminal region of SSIII can interact with SSI [13] The possible regulatory role of this protein makes this isoform a potential target for the manipulation of the level and quality of plant starch ... W366 and Y394 residues of the D2 domain may play a role similar to that of binding sites I and II of GA-1 Mutations of W366 and Y394 in D123 decreased the starch-binding capacity by three- and...

Ngày tải lên: 22/03/2014, 21:20

13 457 0
Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt

Báo cáo " Characteristics of Quaternary sedimentary facies in relation to water bearing capacity of aquifers and aquicludes in the Red River Delta, Vietnam " ppt

... towards  the  center  of plain.  It  is  composed of sand, silt, clay of alluvial facies of Thai  Binh  Formation  (Fig.  2)  in  the  upper  part  and  lens  of sand,  silt,  clay  of Hai  Hung  ... the  results  of chemical  analysis,  the  groundwater  in  the  Holocene  aquifer  has  a  rNa/rCl  ratio  of 1.56,  a  hardness  of 2‐9,  a  pH  of 7.5,  a  TDS  content  of 1.2‐11.7 g/l, in particular its iron content reaches  ... situation  of arsenic  pollution  in  Vietnam,  Department  of Geology and Minerals of Vietnam, Hanoi, 2005.  [5] Tran Nghi, Relationship between the lithofacies  and  ground  water  of Quaternary ...

Ngày tải lên: 28/03/2014, 15:20

7 672 0
Báo cáo khoa học: Increased flexibility and liposome-binding capacity of CD1e at endosomal pH ppt

Báo cáo khoa học: Increased flexibility and liposome-binding capacity of CD1e at endosomal pH ppt

... influence of pH on the structural robustness of rsCD1e2 molecules, we examined the effect of the denaturing agent guanidium chloride at pH and pH 4.8 First, the stability of the secondary structure of ... period of time For comparison, rsCD1b was also analyzed Irrespective of the pH, in terms of resonance units, the interaction of rsCD1e2) with liposomes was considerably higher than that of rsCD1b ... cuvette and a protein concentration of 21 lm The spectra were acquired with a scan rate of 50 nmỈmin)1, a response time of s, a step of 0.2 nm, and a band width of nm, and were averaged over 10...

Ngày tải lên: 28/03/2014, 22:21

12 360 0
Báo cáo khoa học: "Dependency trees and the strong generative capacity of CCG" pot

Báo cáo khoa học: "Dependency trees and the strong generative capacity of CCG" pot

... substituting t into t for some variable x of t, and adding the (appropriately prefixed) list s of nodes of t either before or after the list s of nodes of t Using these two operations, the dependency ... result of the substitution of the term t into t for x is denoted by t[ x := t ] We extend this operation to dependency trees as follows Given a list of addresses s, let xs be the list of addresses ... the strong generative capacities of CCG and TAG, and the beginnings of a formal comparison between CCG and spinal TAG in terms of Linear Indexed Grammars Induction of dependency trees We now explain...

Ngày tải lên: 31/03/2014, 20:20

9 305 0
báo cáo hóa học: " Physical capacity of rescue personnel in the mining industry" ppt

báo cáo hóa học: " Physical capacity of rescue personnel in the mining industry" ppt

... acquisition of data, analysis and interpretation of data, and drafted the manuscript MDM contributed to the study design, acquisition of data, analysis and interpretation of data, and revision of the ... large proportion of the workforce, undertake an annual event comprising a series of rescue simulations that challenge the teams in various aspects of mines rescue The purpose of this paper was ... height of 12" to the beat of a metronome The first minutes were at a pace of 15 steps per minute and the final minutes were at 27 steps per minute The heart rate from the final minute of each...

Ngày tải lên: 20/06/2014, 00:20

6 471 0
Báo cáo hóa học: " Hadamard upper bound on optimum joint decoding capacity of Wyner Gaussian cellular MAC" ppt

Báo cáo hóa học: " Hadamard upper bound on optimum joint decoding capacity of Wyner Gaussian cellular MAC" ppt

... their effect on the optimum joint decoding capacity of system under consideration Appendix A An Alternate Proof Of (18) Proof: We derive an alternate version of (17) for rank one matrices G and Ω ... existence of the proposed upper bound In the second part of this article, we derive the analytical form of HUB by approximating the probability density function (PDF) of Hadamard product of channel ... robustness of the above mentioned technique for maximizing the capacity of the worst fading channel [3-6] Under these circumstances, the most commonly used figure of merit in the analysis of MIMO...

Ngày tải lên: 20/06/2014, 22:20

13 422 0
Báo cáo hóa học: " The impact of spatial correlation on the statistical properties of the capacity of nakagami-m channels with MRC and EGC" pdf

Báo cáo hóa học: " The impact of spatial correlation on the statistical properties of the capacity of nakagami-m channels with MRC and EGC" pdf

... improvement of the system performance [29] Page of 12 The temporal behavior of the channel capacity can be investigated with the help of the LCR and ADF of the channel capacity The LCR of the channel capacity ... capacity (or the ergodic capacity) [26], while the CDF of the channel capacity is useful for the derivation and analysis of the outage capacity [26] The mean channel capacity and the outage capacity ... provide insight into the temporal behavior of the channel capacity For example, the outage capacity is a measure of the probability of a specific percentage of capacity outage, but it does not give...

Ngày tải lên: 20/06/2014, 22:20

12 607 0
Báo cáo hóa học: " Research Article Spatial Capacity of UWB Networks with Space-Time Focusing Transmission" pot

Báo cáo hóa học: " Research Article Spatial Capacity of UWB Networks with Space-Time Focusing Transmission" pot

... transmission leads to much lower sidelobes of the transmitted signal, the impact of such kind of interference on the accommodable user density and spatial capacity has not been studied, as far as ... probability, the spatial capacity is the maximal sum transmission rate of all users who can communicate peer-to-peer simultaneously in a fixed area In a landmark paper of ad hoc network capacity [22], the ... factor is or These yield explicit expressions of upper and lower bounds of the spatial capacity, which shows clearly the connections between the spatial capacity and the frame length, multipath delay...

Ngày tải lên: 21/06/2014, 11:20

12 268 0
Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

Báo cáo hóa học: " Research Article A New Achievable Rate and the Capacity of Some Classes of Multilevel Relay Network" potx

... < The capacity C of the network is the supremum of the set of achievable rates GENERALIZED BLOCK MARKOV ENCODING In [3], generalized block Markov encoding is defined as a special case of [2, ... network and decodes all messages of those nodes Parity forwarding was shown to improve previous decode-and-forward strategies, and it achieves the capacity of new forms of degraded multirelay networks ... = w} denote the conditional probability / of error Define the average probability of error of the code, assuming a uniform distribution over the set of all messages n maxw∈W λ(w) w ∈ W , as P...

Ngày tải lên: 21/06/2014, 22:20

10 318 0
w