unusually high variance in the expression of a single gene
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
Ngày tải lên :
17/03/2014, 23:20
... (5¢-GACCTGGAAGAAATACGATTTAGAATGG-3¢) and the Anchor Primer from the kit, and consisted of 30 cycles of at 94 °C, at 55 °C and at 72 °C A 600-bp amplification product was obtained 5¢ RACE-PCR Amplification ... left, A, B) In the sample of primary cell culture of M brassicae, a band with the same apparent molecular weight was labeled by the antiserum, indicating that the protein is also present in the in ... cDNA revealed that there is a polyadenylation signal upstream of the poly (A) Analysis of the primary structure of M brassicae Gqa The putative protein product encoded by the cloned cDNA was aligned...
- 10
- 619
- 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt
Ngày tải lên :
20/06/2014, 23:20
... growth-associated in both the native and recombinant L reuteri strains, while lactate and 3HPA are growth-associated only in the recombinant strain (Figure 6a, b) During the glucose-glycerol cofermentation, ... lower in the recombinant culture, relative to the native strain, during the second half of the logarithmic phase (Figure 5) The batch experiment has revealed that 1, 3-PD, acetate and ethanol are ... elevated rates of lactate and ethanol production The enhanced formation rates of lactate and ethanol observed in the recombinant L reuteri strain could be indirectly linked to the preferential...
- 8
- 399
- 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
Ngày tải lên :
10/07/2015, 14:50
... an approach to teaching and learning reading that uses reading materials that are understandable and meaningful to the learner in order for learners to be able to read large amounts The aim of ... deny the important role of pleasure reading and attitudes towards reading in general, and reading in English in particular There have been some studies investigating students‟ pleasure reading habits ... a large amount of reading Sharing the same opinion, Richards & Schmidt (2002, p 193–194) stated that ER “means reading in quantity and in order to gain a general understanding of what is read...
- 63
- 587
- 1
THE STUDY OF THE EFFECTS OF a CHANGE IN THE EXPRESSION OF MIXED LINEAGE LEUKEMIA 5 ON TRANSCRIPTION REGULATION
Ngày tải lên :
12/10/2015, 17:35
... Antisense 5’-ACGUCACACGUUCGGAGAAdTdT-3’ Sense 5’-CGCCGGAAAAGGGAAAAUAdTdT-3’ Antisense 5’-UAUUUUCCCUUUUCCGGCGdTdT-3’ Sense 5’- CAGCCCUCUGCAAACUUUCAGAAUUdTdT-3’ Antisense 5’-AAUUCUGAAAGUUUGCAGAGGGCUGdTdT3’ ... Taken together, chromatin architecture and its dynamic nature has a crucial role in dictating the fate of DNA-related metabolic processes which include DNA repair/recombination/replication, in ... multi-phosphorylation events that are catalysed by proteinkinase complexes Cdk7-cyclinH phosphorylates RNAPII CTD at Serine-5, generating a hypo-phosphorylated RNAPII (RNAPIIa) that participates in transcriptional...
- 122
- 307
- 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System
Ngày tải lên :
12/09/2012, 15:05
... nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache refresh ... when the data manager relinquishes that memory If the data manager does not process and release the data within an adequate period of time, the data may then be paged out to the default pager In ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and...
- 23
- 1.3K
- 1
Factors influencing borrower’s behavior and decision making patterns in the success of a micro finance model
Ngày tải lên :
06/09/2013, 05:48
... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in ... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income ... facet has a great influence on the behavior of borrowers If the income and savings of the individual is high then he/she is least attracted to debt financing On the other hand, the individual...
- 23
- 552
- 0
Tài liệu “Measuring customer satisfaction in the context of a project-based organization” docx
Ngày tải lên :
15/01/2014, 15:59
... important to differentiate whether CSM is focusing on the satisfaction of the customer organization as a whole or the satisfaction of certain individuals within that organization These are clearly ... expectations and the performance of the organization’s offerings (see e.g Parasuraman et al., 1985 & 1988 & 1991) Another stream of research is the performance-based approach (or linear regression approach) ... ABSTRACT There is a lack of research that focuses on the suitability of the concept of customer satisfaction and the current methods used for measuring it in organizations operating in business-to-business...
- 37
- 1.1K
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... of the known mammalian ESSS proteins reveals a high degree of conservation in the C-terminal domain (including the transmembrane region), but a significant number of differences in the N-terminal ... (a) In the absence of one or more integral membrane subunits the majority of the subunits in the peripheral-subcomplex are accumulated in a stable form, and most likely already associated in a ... Each of the mutants was found to have a premature chain-termination codon within the open reading frame In two of the mutants (CCL16-B11 and V79-G18) the predicted protein is truncated at a position...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
Ngày tải lên :
20/02/2014, 02:21
... significant 5¢-CGGGATCCTAGACCGGCTAACAAGTA-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ 5¢-GGAATTCCCAGTCTGTGTTCAACCG-3¢ ... 5¢-AACTGGTGGCCGAGTGGG-3¢ 5¢-GCCCATTTCAAACTTGAG-3¢ 5¢-GCACATTGGGAAACGCTA-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-CCTGTTGTGCACATTGGG-3¢ 5¢-AATTTTGCATTTGTGATC-3¢ 5¢-ACCTCAAGATGTGCCACT-3¢ 5¢-TCCATCGGTCATGCTCTG-3¢ ... hypoxia on gene expression was absent in cells with a functional inactive HIF or lacking the HIF- 1a protein in general In fact, for the P4ha1I the involvement of HIF in the activation of gene expression...
- 8
- 434
- 0
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
Ngày tải lên :
20/02/2014, 23:20
... migration, the slow migrating complex may be a dimmer and the faster migrating complex migrating with an apparent molecular mass of 200 kDa may be the monomeric form It is interesting that the levels of ... isolated mitochondria was measured by incubating mitochondria in a medium supplemented with ADP and succinate as described in the Materials and methods section Hexokinase and phosphofructokinase ... absence of differential regulation of a specific nuclear gene coding for the subunits of CytOX, changes in the microenvironment of the cell may induce alterations in the catalytic efficiency of mammalian...
- 9
- 554
- 0
Tài liệu In the Shadows of a Fallen Wall docx
Ngày tải lên :
22/02/2014, 06:20
... concrete barricades installed a few days later In addition to the inaccuracy of referring to the two walls as a singular entity, to speak of the Wall as simply a wall is also incorrect In reality, the ... memories are of viewing seminal national events: the first moon landing, the Viet24 BUT FOR THE WEATHER nam War, and the Watergate hearings While the moon landing produced the sort of cheering and ... mother -in- law, Karin’s — then passed through the second floor of the house next door and landed in the third, killing the family hiding in the basement Karin’s family, having taken cover in their...
- 208
- 481
- 0
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
Ngày tải lên :
07/03/2014, 01:20
... is capable of coordinating with other coregulators, including ARA55 and ARA70, to enhance AR transactivation [96,97] These results suggest that the final AR activity may involve balancing and ... a- actinin-4 also binds to the AR and exhibits coregulating properties a- Actinin-4 may target the AR for degradation and ⁄ or antagonize AR synthesis upon the addition of androgen In addition, a- actinin-4 ... that the RPEL domain of MRTF -A binds actin more strongly than the RPEL domain of myocardin, and that the RPEL motif itself is an actin-binding element RPEL1 and RPEL2 of myocardin bind actin...
- 17
- 573
- 0
Incidents in the Life of a Slave Girl Written pdf
Ngày tải lên :
15/03/2014, 03:20
... unhappiness, was the fact that my brother William was purchased by the same family My father, by his nature, as well as by the habit of transacting business as a skillful mechanic, had more of the ... that I did not live on a distant plantation, but in a town not so large that the inhabitants were ignorant of each other's affairs Bad as are the laws and customs in a slaveholding community, the ... Africans? Who can measure the amount of AngloSaxon blood coursing in the veins of American slaves? I have spoken of the pains slaveholders take to give their slaves a bad opinion of the north; but,...
- 196
- 462
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
Ngày tải lên :
16/03/2014, 23:20
... gene (ggcaggaattgaatgcag) or the known 3¢ end of the xdhB gene (gcccagtacctacaagattc) Localization of xdhAB genes on the C acidovorans plasmid was established using the AlkPhos Fig Location of ... molecular mass of 57 752 Da and the a- subunit contains 808 amino acids with a calculated average molecular mass of 87 392 Da The total calculated average molecular mass of the heterotetrameric (a2 b2) ... stored at )80 °C Preparation and expression of XDHABC, containing the gene encoding P aeruginosa xdhC, in E coli NI850 The xdhC gene (PA1522) was amplified from genomic DNA of P aeruginosa PAO1-LAC,...
- 11
- 584
- 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
Ngày tải lên :
23/03/2014, 07:20
... Examination of a wild-type PNS revealed increasing amounts of peroxisomal marker proteins in the pellet fractions upon increasing centrifugation speed (Fig 4) Disintegration of the organellar ... USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA CGAC) ... HEX1 expression (Fig 2B) Remarkably, typical Woronin bodies of N crassa are smaller with an average size of 2934 To corroborate the appearance of hexagonal HEX1 structures in BY4742, this strain...
- 10
- 350
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
Ngày tải lên :
23/03/2014, 13:20
... indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence or presence of p-amindinobenzamidine (A) Effect of trypsinogen ... Trypsin catalyzes the activation of trypsinogen in an intermolecular autocatalytic process The conversion of trypsinogen to trypsin involves the removal of the N-terminal hexapeptide H2N-Val-AspAsp-Asp-Asp-Lys ... period, a rapid increase in trypsin activity was observed The lag phase of the S-shaped activation curve is shortened by an increase in the trypsinogen concentration, and the maximal trypsin activity...
- 8
- 403
- 0
Báo cáo khoa học: "Current Research in the Development of a Spoken Language Understanding System using PARSEC*" ppt
Ngày tải lên :
23/03/2014, 20:20
... feedback about impossible word candidates • We have been able to incorporate the durational information from Bear and Price quite easily into our framework An advantage of our approach is that the ... prosodic information is added as constraints instead of incorporating it into a parsing grammar Because CDG is more expressive than context-free grammars, we can produce prosodic rules that are more ... Harper Parsec: An architecture for parallel parsing of constraint dependency grammars In Submitted to The Proceedings o /the ~9th Annual Meeting o.f ACL, June 1991 [3] H Maruyama Constraint dependency...
- 2
- 359
- 0
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
Ngày tải lên :
18/06/2014, 18:20
... ELISA-assay remained negative throughout follow-up in of the seven cases (Table 1) We also investigated reactivity against single HCV proteins by the INNO-LIA HCV III assay A faint band against the ... proteins) (*) Patient 13 had a faint band against the C2 protein at the second time point investigated (after HCV clearance) (**) Patient 80 had HCV serotype Genotyping was not performed in the initial ... experiments To avoid inter-assay variability, all serial samples follow-up of one individual were tested in the same assay A stimulation index (SI) of >2.5 in the proliferation assay was considered...
- 11
- 528
- 0
báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx
Ngày tải lên :
18/06/2014, 19:20
... that children ages 8–17 can talk about and respond to items asking them about their health and well-being They can also offer unique insight into the understandability of the items These findings ... agreed to allow their child to participate, they were scheduled for an interview date At the time of the interview, a trained research assistant obtained parental informed consent and the children ... items, and the basis for the response for each item [9] Cognitive probes elicit information regarding the clarity and rationale of the directions, the meaning of the items, the appropriateness of the...
- 10
- 480
- 1