unsteady state response of a nonlinear tubular reactor

... exchange chromatography SDS ⁄ PAGE analysis in the presence of b-mercaptoethanol indicated that the purified Spatzle had an ¨ apparent molecular mass of 38 kDa, which is slightly larger than that ... be active Incubation of proHP8Xa with factor Xa resulted in the appearance of a 34 kDa band corresponding to the catalytic domain (Fig 6A) , as previously observed A B Fig SDS ⁄ PAGE analysis of ... was activated by factor Xa, IEARase activity increased significantly above that of factor Xa alone, which could also hydrolyze the substrate (Fig 6B) These results indicated that factor Xa cleaved...

Ngày tải lên: 06/03/2014, 09:22

... Ability and adaptability to learn, generalisation, less information requirement, fast real-time operation and ease of implementation have made ANNs popular in the last few years ANNs have been applied ... the Backpropagation (BP) [9], which is the most popular algorithm in the arena of neural networks Backpropagation The standard backpropagation by Rumelhart and McClelland has been demonstrated ... position as a parameter This method is based on storing the (ψ/θ/i) information in a look up table Elmas and Zelaya de la parra [4] described a similar method which applies Least Squares curve...

Ngày tải lên: 28/04/2014, 10:17

... differential-difference equations J Frac Calculus 10, 101–107 (1996) El-Sayed, AMA, Gaafar, FM, Hamadalla, EMA: Stability for a non-local non-autonomous system of fractional order differential equations ... Kilbas, AA, Srivastava, HM, Trujillo, JJ: Theory and Applications of Fractional Differential Equations Elsevier, Amsterdam (2006) Podlubny, I: Fractional Differential Equation Academic Press, San ... Cite this article as: El-Sayed and Gaafar: Stability of a nonlinear non-autonomous fractional order systems with different delays and non-local conditions Advances in Difference Equations 2011...

Ngày tải lên: 20/06/2014, 22:20

... stability and oscillation of a family of difference equations J Math Anal Appl 294, 614–620 (2004) doi:10.1016/j.jmaa.2004.02.039 Sun, T., Xi, H.: Global attractivity for a family of nonlinear ... doi:10.1016/j.aml.2005.10.014 doi:10.1186/1687-1847-2011-36 Cite this article as: Shi et al.: Dynamic behavior of a nonlinear rational difference equation and generalization Advances in Difference Equations ... various equation listed above suggests that the same potentially holds for similar rational equations We can deduce the following natural generalization of (1.1) and (1.4) Corollary Let s Î N+ and Zs...

Ngày tải lên: 20/06/2014, 22:20

... Switzerland, 1992 a 10 J Appell, N A Erzakova, S Falcon Santana, and M V¨ th, “On some Banach space constants arising a in nonlinear fixed point and eigenvalue theory,” Fixed Point Theory and Applications, ... J Bana´ , J Rocha Martin, and K Sadarangani, “On solutions of a quadratic integral equation of s Hammerstein type,” Mathematical and Computer Modelling, vol 43, no 1-2, pp 97–104, 2006 R R Akhmerov, ... Commentationes Mathematicae Prace Matematyczne, vol 44, no 1, pp 39– 53, 2004 J Bana´ and A Martinon, “Monotonic solutions of a quadratic integral equation of Volterra type,” s Computers & Mathematics...

Ngày tải lên: 21/06/2014, 20:20

... (33) and in (34) provide accurate estimates of the steady -state MSE and of the steady -state A Carini and G L Sicuranza Table 3: First eight coefficients of the MMS solution (wo ) and of the asymptotic ... Steady -state behavior We are here interested in the estimation of the mean-square error (MSE) and the mean-square deviation (MSD) at steady state The adaptation rule of (15) provides different values ... Theoretical (- -) and simulation values (–) of steady -state MSE versus step-size of the FX-PE-AP algorithm (a) at even samples with a nonlinear controller, (b) at odd samples with a nonlinear controller,...

Ngày tải lên: 22/06/2014, 22:20

... Math Anal Appl 305 (2005) 291–295 I Gy˝ri and G Ladas and P H Vlahos, Global attraction in a delay difference o equation, Nonlin Anal 17 (1991) 473–479 G Karakostas, Ch G Philos, and Y G Sficas, ... persistence and global stability in models of population growth, J Math Anal Appl 308 (2005) 195–207 Dang Vu Giang and Dinh Cong Huong, Nontrivial periodicity in discrete delay models of population ... improve the presentation of this paper References R P Agarwal, Difference Equations and Inequalities Theory, Methods, and Applications, Marcel Dekker Inc., New York, 2000 Dang Vu Giang and Dinh Cong...

Ngày tải lên: 06/08/2014, 05:20

... regarding a likely partial gastrectomy but also informed that a total gastrectomy and even a multi-visceral resection may be needed At operation, he was found to have a softball-sized mass attached ... resistance to Imatinib in advanced gastrointestinal stromal tumors are predicted by different prognostic factors: A European Organisation for Research and Treatments of Cancer-Italian Sarcoma Group-Australasian ... was needed Dagher R, Cohen M, Williams G, Rothmann M, Gobburu J, Robbie G, Rahman A, Chen G, Staten A, Griebel D, Pazdur R: Approval Summary: Imatinib mesylate in the treatment of metastatic and/...

Ngày tải lên: 09/08/2014, 04:21

... Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... groups of animals Again, one non-human primate in Group showed an undetectable viral load following raltegravir Page of 19 Figure Association of viral load decrease with raltegravir treatment of...

Ngày tải lên: 12/08/2014, 23:23

... scheme of which is represented in Fie The vibrator consists of a cantilever beam and a block of mass /?/, which is made of magnetic material The elastic force of the beam is assumed to have a nonlinear ... RESONANCE OF A N O N LIN EA R VIBRATO R U N D ER TH E ACTIO N OF E LEC T R O M A G N ET IC FO R C E N G l'V E N VA N DAO (H A N O I) This paper deals with the parametric resonance of a nonlinear ... the parametric oscillatiòn On the phenomenon o f parametric resonance o f a nonlinear vibrator 283 It is to be noted that the linear oscillation of the mass m in a similar electromechanical system...

Ngày tải lên: 08/04/2015, 15:30

... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... Health Association/American Water Works Association/Water Environment Federation, Washington DC, USA Tsuneda S., Nagano T., Hoshino T., Ejiri Y., Noda N and Hirata A (2003) Characterization of ... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8...

Ngày tải lên: 05/09/2013, 10:15

... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are all ... performance of each state is defined as the minimum capacity of each interval, that is: g1 = 5200 , g = 5550 , g3 = 5700 , g = 5850 , V RELIABILITY ANALYSIS OF THE POWER SYSTEM The reliability of ... optimization in multi -state series-parallel systems: A heuristic approach,” IIE Transactions, 2007, Vol.39, pp.277–289 Y Liu, H.Z Huang, “Comment on ‘ A framework to practical predictive maintenance...

Ngày tải lên: 03/01/2014, 19:38

... the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated techniques ... information about ValEncIA-IVP as well as free software are available at http://www.valencia-ivp.com 3 assumed to be given in state space representation p (t) = ∆p (t), where both p (t) and ∆p ... controllers For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating enclosures of all reachable states These results have to...

Ngày tải lên: 12/01/2014, 22:04

... challenges and barriers in communication, organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication ... hospitals will face in a mass casualty event (MCE) include surge capacity and capability issues in emergency and trauma services, as well as medical, paramedical, administrative, logistical, and ... gradual withdrawal based on gathered information, helps avoid delay • Linear Mobilization of Resources: Linear transition (a form of reactive approach) from normal operations to appropriate response...

Ngày tải lên: 19/02/2014, 03:20

... size of parameters until additional parameters are demanded by data Equally important, the quality of architectural simplicity should be maintained Among the different sources of information manipulated ... Journal of Memory and Language,, 47:50–68, 2002 C.D Manning and H Sch¨ tze Foundations of u Statistical Natural Language Processing The MIT Press, Cambridge, Massachusetts, 1999 S Narayanan and ... A total of 30 pairs of a garden-path sentence and its ambiguous, non-garden-path control were tested for a comparison of the probability decrease at the disambiguating region In 80% of the cases,...

Ngày tải lên: 20/02/2014, 11:21

... 3027 STAT3 and MAPK activation by Hyper-CNTF in transfected BAF/3 cells Downstream signal transduction pathways were analyzed by studying the activation level of JAK/STAT and MAP kinase signaling ... We have successfully expressed an active fusion protein of human CNTF and human soluble CNTF-R in mammalian cells Hyper-CNTF has a calculated molecular mass of 60 kDa and apparent molecular mass ... outgrowth is most likely mediated by activation of the MAPK pathway and that this response is substantially independent of the JAK/STAT pathway DISCUSSION Fig STAT3 and MAPK activation by Hyper-CNTF in...

Ngày tải lên: 22/02/2014, 07:20

... have been reported to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and ... culture filtrates of Ceratocystis fimbriata f sp platani, in the cell walls of ascospores, hyphae and conidia of this fungus The authors suggested that cerato-platanin may have a similar role to ... located in the cell walls of ascospores, conidia and hyphae of Ceratocystis fimbriata f sp Platani FEMS Microbiol Lett 233, 341–346 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala...

Ngày tải lên: 07/03/2014, 12:20

... mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT GCTGCAGCAGA-3Â (reverse); for the H539V mutant, 5Â-CGACAAGGCGGGCGTC ACGTTA ACGCTGCCTGTCC-3Â (forward) ... dissociation of dodecameric CDase I-5, sedimentation equilibrium 110 Fig Apparent molecular mass of CDase I-5 at various pH values determined by analytical ultracentrifugation analysis analysis was performed ... His89 to 118 Val89, and His539 to Val539 using the following primers: for the H49V mutant, 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse);...

Ngày tải lên: 07/03/2014, 12:20

... pretreatment; H + ParA1, ParA1 infiltration after H2O treatment; A4 00, 400 lM ABA pretreatment; A + ParA1, ParA1 infiltration after ABA treatment All the spectra were representative of at least three ... PR, PA (ParA1 plus adenine), PT (ParA1 plus thiourea), PV (ParA1 plus ascorbic acid) and PC (ParA1 plus catalase) were infiltrated into the same leaves of tobacco plants, which had been sprayed ... (lower panel) Mean values ± standard error of at least three replicates are presented (B) The EPR measurements indicated that the leaves pretreated with ABA had a higher OH• level after ParA1 treatment...

Ngày tải lên: 15/03/2014, 00:20

Ngày tải lên: 16/03/2014, 03:20