... image or animation stored and generated using absolute or relative coordinates that include X (horizontal), Y (vertical) and Z (depth) dimensions Standard file formats and standard languages for developing ... languages such as C++, Java and Visual Basic, and even in machine code or assembly language Any high-level programming language that supports arrays may be used to develop graphics transformation ... NET My Services service .ORG A domain category that generally signifies an organisation (See Domain.) / A forward slash used as a separator in URL addresses such as https:// www.FrancisBotto.com,...
Ngày tải lên: 29/05/2014, 15:31
... Witherspoon”, or more verbose natural language queries such as “I’m looking for a movie called Legally Blonde” and “Do you have romantic comedies” An important advantage of speech is that it makes it easy ... control is more familiar to users and allows for a more relaxed interaction since they can lean back on the couch Also many users are concerned about the quality of their handwriting and may avoid ... Acknowledgements Thanks to Keith Bauer, Simon Byers, Harry Chang, Rich Cox, David Gibbon, Mazin Gilbert, Stephan Kanthak, Zhu Liu, Antonio Moreno, and Behzad Shahraray for their help and support Thanks also...
Ngày tải lên: 20/02/2014, 12:20
Báo cáo khoa học: "A speech interface for open-domain question-answering" doc
... and V Balasubramanian 1994 Speech-based retrieval using semantic co-occurrence filtering In Proc ARPA Human Lang Tech Workshop, Plainsboro, NJ, mar E Schofield and G Kubin 2002 On interfaces for mobile ... The roxana video diaz What is the shortest day of the year Where Can I find Frog T-Shirts Where can I find cheats for Soul Reaver for the PC How can I plug my electric blanket in to my car cigarette ... The authors would like to thank Stefan R¨ ger for u his suggestions and moral support Ed Schofield’s research is supported by a Marie Curie Fellowship of the European Commission References J Allan...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "From Information Structure to Intonation: A Phonological Interface for Concept-to-Speech" pot
... tactical generator only candidate positions for both pitch accents and phrasal boundaries are selected This reflects the fact that though prosody heavily depends on grammaticM and pragmatic factors, ... sequence paradigm The handling of accentuation and phrmsing by the generator resembles the syntacto-semantic approaches Only a few tags such as emphasis [EMPH] and (conceptual or textual) givenness ... Figure 1: Architecture This architecture forms an ideal platform for the implementation of the phonological interface Necessary adaptions are limited to the data used: An existing grammar was extended...
Ngày tải lên: 08/03/2014, 06:20
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc
... that arise during Spanish-Catalan translation at several levels: orthographic, morphological, lexical, semantic and syntactic errors Works towards the automatic identification and classification of ... application obtains the measures for all the metrics and levels and generates an interactive table of scores displaying the values for all the measures Table organiza- 142 Graphically-aided Error Analysis ... Federico, Patrik Lamn bert, and Rafael Banchs 2006 Morpho-Syntactic Information for Automatic Error Analysis of Statistical Machine Translation Output In Proc of the SMT Workshop, pages 1–6, New York...
Ngày tải lên: 16/03/2014, 20:20
Lab 3.1.5 Configuring a Serial Interface
... the name and passwords for Router a On Router 1, enter the global configuration mode and configure the hostname as shown in the chart b Configure the console, virtual terminal and enable passwords ... the name and passwords for Router a On the Birmingham router, enter the global configuration mode Configure hostname, console, virtual terminal and enable passwords as shown in the previous chart ... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged EXEC mode, enter the command erase startup-config...
Ngày tải lên: 05/11/2013, 12:15
Tài liệu Lab 3.1.5 Configuring a Serial Interface pptx
... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged exec mode enter the command erase startup-config ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... exit Turn the router off Remove and store the cables and adapter 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1.5 Copyright 2003, Cisco Systems, Inc Erasing and reloading the router Enter...
Ngày tải lên: 11/12/2013, 13:15
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface doc
... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0...
Ngày tải lên: 11/12/2013, 13:15
Tài liệu Troubleshooting a Serial Interface doc
... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0...
Ngày tải lên: 11/12/2013, 15:15
Tài liệu Lab 3.1.5 Configuring a Serial Interface ppt
... typing enable If prompted for a password, enter class If “class” does not work, ask the instructor for assistance Router>enable At the privileged exec mode enter the command erase startup-config ... configuration is not saved The router uses the startup configuration when the router is started Step Display information about Serial interface on GAD a Enter the command show interface serial on GAD ... exit Turn the router off Remove and store the cables and adapter 3-5 CCNA 2: Routers and Routing Basics v 3.0 - Lab 3.1.5 Copyright 2003, Cisco Systems, Inc Erasing and reloading the router Enter...
Ngày tải lên: 18/01/2014, 04:20
Tài liệu Lab 3.1.7 Troubleshooting a Serial Interface pdf
... identify what type and how many interfaces the router has There is no way to effectively list all of the combinations of configurations for each router class What is provided are the identifiers for ... typing enable If prompted for a password, enter class (if that does not work, ask the instructor) Router>enable At the privileged exec mode enter the command erase startup-config Router#erase startup-config ... the Paris router using the NO version of the command and then add it to the London router configuration Step Enter the command show interface serial on Paris Paris#show interface serial a Serial0...
Ngày tải lên: 24/01/2014, 19:20
Tài liệu Báo cáo khoa học: "An ERP-based Brain-Computer Interface for text entry using Rapid Serial Visual Presentation and Language Modeling" ppt
... magnitude of the trial and distractor responses at channel Cz on a single-trial basis, rather than averaged over all trials The signals acquired from each EEG channel are incorporated and classified ... high-dimensional data, singularities of these matrices are problematic RDA applies regularization and shrinkage procedures to the class covariance matrix 40 Figure 4: Single-trial EEG data at channel Cz corresponding ... (QDA) model Assuming each class has a multivariate normal distribution and assuming classification is made according to the comparison of posterior distributions of the classes, the optimal Bayes...
Ngày tải lên: 20/02/2014, 05:20
Báo cáo: THIẾT BỊ LƯU TRỮ USB (Universal Serial Bus ) potx
... màu xanh, nhằm báo hoạt động ghi chép ổ đ a 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ II TÌM HIỂU VỀ CỔNG USB Ngày hầu hết máy tính trang bị nhiều cổng USB (Universal ... nhanh dễ dàng So với cách kết nối thiết bị với máy tính dùng cổng song song (Parallel Port), dùng cổng nối tiếp (Serial Port) hay dùng Card đặc biệt thiết kế cài đặt sẵn bên máy tính USB nhanh ... Joystick, Digital Camera, Webcam, Modem, loa, điện thoại, Network Connection, thiết bị lưu trữ thông tin (ổ Zip) 07/31/14 ~^~ TỔNG QUAN VỀ USB ~^~ Thông thường máy tính có hai khe cắm USB...
Ngày tải lên: 31/07/2014, 11:20
AN1157 a serial bootloader for PIC24F devices
... certification for its worldwide headquarters, design and wafer fabrication facilities in Chandler and Tempe, Arizona; Gresham, Oregon and design centers in California and India The Company’s quality ... data and are not included in the checksum COMMANDS The data field for each packet contains one command and its associated data The commands are detailed in Appendix A: “PIC24F Serial Bootloader ... ExportP24HEXFile() L ValidateHEXFile() CLEAR SortAndPadFiles() Parse Memory Files and Save as Formatted HEX Files C Sort Memory Files, Pad to Handle Bad HEX Files EraseDataFiles() Clear Data from...
Ngày tải lên: 11/01/2016, 16:47
Serial Interface (SCI)
... specifications are assumed here, and hardware design and register value settings are conducted accordingly • • • • • • Data transfer mode and level Data transfer speed Data transfer format Multiprocessor ... voltage, is output to notify the other party of the start of data transmission and 7- or 8-bit data are output After that, the parity bit is output if an error is detected At the end of transmission, ... characteristics of serial data input/output compared with that of parallel data? Enter an appropriate word in parentheses Answer It takes (longer) time for inputting/outputting the same bit count of data It...
Ngày tải lên: 29/09/2013, 11:20
Serial Interface to PIC
... size and requires no external capacitors The applications developed in this chapter resorts to MAX-232 for achieving compatibility Online tutorials for indepth information regarding the RS-232 and ... draws a merely 60 A of current from the supply Onchip ADC of the PIC16F877 is used for digitization of the analog signal corresponding to the temperature data The datasheets of LM35 and OP-07 are ... modified of course by addition of few more hardware components and using port lines to build a home automation project Program 4.4 Controlling an actuator such as relay from PC HyperTerminal Program...
Ngày tải lên: 03/10/2013, 01:20
Tài liệu Báo cáo khoa học: "A text-based search interface for Multimedia Dialectics" ppt
... cross-lingual information resources for automatically expanding and generalising the data (semantic relations) one can mine from the corpus Figure 1: The COSMOROE cross-media relations For annotating a ... serve as simple search interface for general users, taking advantage of the rich semantic annotation —behind the scenes— for more precise and intelligent retrieval of audiovisual files tions: semantic ... background and to another image of a “bell”, through a metonymic relation of type “part for whole” What is actually happening, from a semantic point of view, is that although the video talks about...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: "A spoken dialogue interface for TV operations based on data collected by using WOZ method" pptx
... processing of the system The IFR has been given the appearance of a stuffed animal One advantage of this IFR is that it can be directly touched and manipulated to create a feeling of warmth and closeness ... Example of pattern matching Table 1: Meta-characters used in pattern Meta-character * + ! {} [] () @ | , Description any number of any words one word non-matching word optional mandatory any order ... hearing a greeting or being called by its name, the IFR opens its eyes and enters a state that can perform various operations For example, the IFR can assist the user search for a program, can...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... sets of walking primers for fragment amplification FA2-L and FA2-R Here we select "CTTTTTC" of X ORF as the start point FA1-L' and FA4-L' are degenerate primers Figure gel Agarose3 analysis of...
Ngày tải lên: 18/06/2014, 18:20