ultimate load capacity of columns strengthened under preload

... comparative analysis of the thermal insulation capacity of various types of roof materials used in Sub-Sahara African regions in order to propose the thermally efficient roof material that would ... atmospheric one However, the thick of the straw is not only for low room temperature but also to render the roof waterproof Roof waterproofing is the first intent of ISSN 2076-2895 (Print), ISSN ... treatment of the building cover, that is, the use of reflective colors and surfaces, reduces the temperature of the room [10] Another observation is the impact of water on the roof temperature Four of...

Ngày tải lên: 09/09/2015, 10:32

... Mix C under Loading Case L0-A 156 App-A12 Graph for Mix C under Loading Case L0-B 156 List of Figures xii App-A13 Graph for Mix C under Loading Case L1-A 157 App-A14 Graph for Mix C under Loading ... II under Loading Case IS1-A 168 App-A36 Graph for Mix II under Loading Case IS1-B 168 App-A37 Graph for Mix II under Loading Case LM-A 169 List of Figures xiii App-A38 Graph for Mix II under Loading ... Graph for Mix B under Loading Case S1-A 152 App-A4 Graph for Mix B under Loading Case S1-B 152 App-A5 Graph for Mix B under Loading Case IS0-A 153 App-A6 Graph for Mix B under Loading Case IS0-B...

Ngày tải lên: 16/09/2015, 15:54

... ground under loading- Test Ar15 Figs 4.5 (a)- (b) Deformation of ground under loading- Test Ar22 Figs 4.6 (a)- (d) Deformation of ground under loading- Test Ar28 Fig 4.7 Post-mortem picture of test ... view of loading setup for tests Ar15, Ar22 and Ar28 Fig 4.2 Schematic of typical loading test Figs 4.3 (a)- (d) Deformation of ground under loading- Test Ar0 Figs 4.4 (a)- (b) Deformation of ground ... increased load on the column at the edges of the tank, the outer ring of columns was installed at a smaller spacing Four “rings” of columns extended beyond the periphery of the tank (Fig 2.5) The columns...

Ngày tải lên: 01/10/2015, 11:39

... still required because of the reductions in the size of the limb Because of this need of constant adjustments, we noticed that treatment centers require the services of a professional seamstress ... movements of the elbow Active exercising devices A series of active exercising devices were developed thereby enabling the creation of a laboratory of apparatuses for the treatment of lymphedema ... which they are able to dress and take off alone or with the help of a member of the family, can experience a reduction in the lymphedema Adaptation of many types of chores enables these patients to...

Ngày tải lên: 26/10/2012, 09:39

... same type of credit This kind of L/C allows the seller to transfer all or part of the proceeds of the original letter of credit to a second beneficiary, usually the ultimate supplier of the goods ... in favour of confirmed credits From a seller’s perspective, of course, a confirmed credit brings the advantages of “a definite undertaking of the confirming bank, in addition to that of the issuing ... Standard for examination of documents The last but not the least is the problem concerning the standard for examination of documents The undertaking of bank to pay under a letter of credit transaction...

Ngày tải lên: 27/10/2012, 16:40

... effect of biofilm on the adsorption capacity of PAC, PAC covered with biofilm was made and its adsorption capacity was compared to the adsorption capacity of new PAC repeated times For biofilm ... 3.3 Effect of biofilm on PAC on adsorption capacity of PAC Although the adsorption of DOM with molecular weight ranging from 50,000 to 300,000 Da decreased the adsorption capacity of PAC in the ... adsorption capacity of PAC decreased with incubation time In other word, the adsorption capacity of PAC increased with increase in the amount of organic carbon on PAC The adsorption capacity of PAC...

Ngày tải lên: 05/09/2013, 08:40

... and optimize the performance of heat engines, heat pumps and refrigerators The objective of this work is to obtain the cooling load and the maximum cooling load of a refrigerator with internal ... load increases to reach a maximum value and then decreases as ω increases Figure shows the variation of the cooling load with the temperature ratio ω for different values of the coefficient of ... that there exists a maximum values of cooling load for β = 2.5 and β = For β = , the cooling load monotonically decreases as ω increases The effect of the ratio of high temperature heat sink to...

Ngày tải lên: 05/09/2013, 15:28

... the State of West Bengal He is a Member of the Editorial Board of Journal of Water Resource & Protection of Scientific Research Publication, and a Member of the Editorial Advisory Board of International ... burning of open wood waste piles J .of Env Manag 2009, 90(8), 2393–2401 DCL, Dispersion of Pollutants in Air Emitted from Multiple Sources: Volume – I Report prepared under the aegis of Ministry of ... development of a computational tool in the form of a software for serving the designers in evaluating the effect of power plant operations on the ambient air quality in terms of concentration level of...

Ngày tải lên: 05/09/2013, 16:10

... to the length of all fields, the precision and scale of columns as appropriate The sp_help system stored procedure takes one optional parameter When this parameter is the name of a table object, ... (nchar, nvarchar, and ntext) report double the value of the MaxLength property of the column object In the example, the ShipCountry column of the Orders table reports MaxLength = 15 (stores a ... iterates over the collection of columns in the table and displays the length, precision, and scale for each from the Hashtable Information from the FillSchema( ) method of the DataAdapter is also...

Ngày tải lên: 24/12/2013, 05:15

... factor under the risk-based measure One-year maturity floor Claims on banks Treatment of trade finance under the Basel capital framework Treatment of trade finance under ... in the context of short-term self-liquidating letters of credit Under this approach, the exposure’s risk weighting depends on the rating of the issuing bank The risk weighting of an unrated bank ... scarce on the relative importance of the different types of trade credit, rough estimates based on ICC data show that letters of credit represent approximately 20% of all trade finance instruments...

Ngày tải lên: 17/02/2014, 21:20

... disposal" of specified wastes and disposal of hazardous waste through underground injection within 114 mile (0.40 km) of an underground source of drinking water Pursuant to Subtitle C of RCRA, ... probability of detection of at least 95 percent and a probability of false alarm of no more than percent Simply stated, this means that, of I00 tests of USTs leaking at the specified rate, at least 95 of ... meets a performance standard of detecting a leak of 0.2 gallons per hour with a probability of detection of at least 95 percent and a probability of false alarm of no more than percent Regulatory...

Ngày tải lên: 06/03/2014, 23:20

... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig ... masses (kDa) are shown to the right of the gel (B) Autoradiogram of the gel shift assay shows the binding of varying concentrations (0.2–2 lM) of CI to a fixed amount of O1 DNA mix ( 0.1 nM 32P-labeled ... structure of the CTD of /11 CI, the X-ray structure of a putative DNA binding protein (Protein Databank code: 3bs3) of Bacteroides fragilis was used as a template for generating the model structure of...

Ngày tải lên: 07/03/2014, 00:20

... dissociation of the corresponding peptide ions and examination of the resultant spectra for the presence of the signals produced by ‘neutral loss’ of phosphoric acid, which are characteristic of phosphorylated ... Positions of the peptides in the sequence of the mature CP29 are indicated by corresponding amino acid numbers The sequences of the peptides 1–4 were obtained after in-gel digestion of the putative ... is no other report of any thylakoid protein undergoing quadruple phosphorylation To determine the extent of CP29 phosphorylation in State we performed similar MS analyses of thylakoid membranes...

Ngày tải lên: 07/03/2014, 21:20

... area under the curve and shifts to lower values of sf in the presence of peptide are Table Hydrodynamic properties of Myr2Gro-PCho/TO size-fractionated lipid emulsions Lipid emulsions composed of ... fraction in the presence of both apoE isoforms However, a greater increase in the ordinate maximum and area under the curve is obvious in the presence of the apoE4 isoform (Fig 7C, open symbols), ... yielded individual fractions of particles with radii in the range of 38–52 nm Flotation velocity analysis of fractionated lipid emulsions The solution properties of the major emulsion fractions...

Ngày tải lên: 08/03/2014, 09:20

... temperature treatment of CPY under 400 MPa exhibits a cold inactivation of the enzyme, in which an irreversible damage is evident Effect of 2-mercaptoethanol upon cold inactivation of CPY under high pressure ... temperature below )10 °C Reversibility of low temperature inactivation of CPY under high pressure Time-dependent recovery of CPY activity was observed after the release of pressure (Fig 4) When CPY activity ... Fig Kinetics of the pressure inactivation of CPY at 400 MPa under different temperatures Enzymic activities of CPY at different time points were measured while CPY was pressurized under 400 MPa...

Ngày tải lên: 08/03/2014, 10:20

... leading causes of under- five mortality, accounting for 30% of total deaths, 25% of infant mortality, and 11% of maternal deaths, with over Page of 10 90% of the population at risk of malaria [4] ... management of malaria among the mothers of under- 5 s in Ogun State, Nigeria Primary healthcare as stated in the Alma Ata declaration underscores the importance of health education as one of the key ... considered the effect of multiple interventions on attitude, knowledge, and treatment seeking behavior of mothers of under 5 s This study was therefore designed to determine the effect of health education...

Ngày tải lên: 14/03/2014, 21:20

... proof of Lemma in Section was suggested by one of the referees LOGARITHMIC CAPACITY OF POLYGONS 281 Logarithmic capacity and reduced module There are several other approaches to the measure of ... D = ∅, the base of T lies on ∂D (the base of T need not consist of an entire side of D), S ∩ D = ∅, and if each (closed) side (not base!) of S contains at least one vertex of D Of course, the ... logarithmic capacity, admits an explicit upper bound B given by a weighted sum of the reduced modules of triangles composing D, each of which has a distinguished vertex LOGARITHMIC CAPACITY OF POLYGONS...

Ngày tải lên: 14/03/2014, 22:20

... International cafeteria Plenty of parking Open everyday hour stop Pick up/drop off location Part of my job is to recommend good tours of LA for people I have to say Legends of Hollywood tour kicks other ... photo's of celebrity homes in front of the house (see what's behind the gates and bushes) See the best view of the Hollywood Sign Visit Grauman's Chinese Theatre, Hollywood Boulevard and the Walk of ... effects, footage etc He is committed to creating the ultimate tour of Los Angeles, Hollywood and Beverly Hills Mark is the tour director of Legends Of Hollywood Tours and would love to show you around...

Ngày tải lên: 16/03/2014, 17:20

... det det Note that for a sentence of length k, the power of LCA(k) is idcnticM to the weak generative capacity of the full underlying grammar But since the size of sentences (tag sequences) in ... refer to the set of lcxicaUy valid readings of a given word We use the term path to refer to a sequence of M tags ( M ~ N) which is a tagimage corresponding to the words W, , WN of a given sentence ... studies of modern written ! lebrew suggest that about 60% of the word-forms in running texts are ambiguous with respect to a basic tag set, and the :average number of possible readings of such...

Ngày tải lên: 18/03/2014, 02:20

... (including several SS isoforms) are capable of associating in a multisubunit complex, and that these interactions may be of physiological importance [13,14] One of the soluble SS isoforms, SSIII, has ... N-terminal region of SSIII can interact with SSI [13] The possible regulatory role of this protein makes this isoform a potential target for the manipulation of the level and quality of plant starch ... parameters of the SBD proteins and CD purified separately and mixed in a test-tube We determined that, under saturating conditions of both substrates, the addition of : 1, : and : molar amounts of the...

Ngày tải lên: 22/03/2014, 21:20