uhm hum and why interacting with participants is also your difficulty when having a role as a facilitator
báo cáo khoa học: "Prediction of genetic merit from data on binary and quantitative variates with an application to calving difficulty, birth weight and pelvic opening" pot
Ngày tải lên :
09/08/2014, 22:23
... u and v was , where G is a 3x33 matrix calculated c matrix was taken as T as was was assumed to be vague The covariance in (31) The unconditional where p is the genetic correlation between traits ... aid, and 5: cesarean) For the purpose of the analysis, twin calves were excluded and calving difficulty was recoded as: a) «Easy»(scores 1, and 3) or b) «Difficult»(scores and 5) The data s are ... in analysis of categorical data with linear models , IANOLA (e.g., G 1982) are eliminated For example, when calving difficulty is measured as an «all or none trait, sire x sex of calf interactions...
- 23
- 325
- 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
Ngày tải lên :
19/02/2014, 05:20
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG...
- 14
- 517
- 0
BÀI THẢO LUẬN TIẾNG ANH in managing people, the occurrence of conflict is inevitable. In opinion, What is conflict at work? How do managers deal with conflict and why do they need to resolve these problem ? Give an example of an event where conflict were
Ngày tải lên :
13/05/2017, 22:04
... the organization is an important skill for all managers as well as for individuals in general A survey of US researchers found that an average manager spent 21% of the week in dealing with business ... Bui Tuan Anh II.4 : Nguyen Ngoc Anh II.5 and III : Pham Van Anh II.6 and Secretary : Nguyen Ngoc Anh Head of team No Secretary Name Nguyen Thi Kim Anh Bui Tuan Anh Nguyen Ngoc Anh Pham Van Anh ... compromise is that none of the parties are truly satisfied with the results, as they probably didn't gain what they really wanted While the result may be a temporary truce, the lingering dissatisfaction...
- 11
- 1.5K
- 1
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
Ngày tải lên :
14/02/2014, 19:20
... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... to assess the kinase activity and GST alone was used as a negative control The top panel shows the kinase assay visualized by autoradiography and the bottom panel shows the Coomassie Brillian...
- 11
- 700
- 0
Tài liệu Báo cáo khoa học: Diol dehydratase-reactivating factor is a reactivase – evidence for multiple turnovers and subunit swapping with diol dehydratase pdf
Ngày tải lên :
15/02/2014, 01:20
... release of adenine-lacking cobalamins, such as CN-Cbl and damaged cofactor The fact that the relative efficiencies of metal ions for the reactivation are not always correlated with the ATPase activity ... respectively, and the a and b subunits of the reactivase are abbreviated as aR and bR, respectively, molar ratios of aD, bD, cD, aR and bR in bands i and vi were determined to be about : : : : and : : : ... reactivating factor while it exists as an active holoenzyme The glycerol dehydratase-reactivating factor reactivates the inactivated hologlycerol dehydratase in a similar manner Both dehydratase-reactivating...
- 13
- 620
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGG ... luciferase constructs and, as control, mock (pcDNA3) transfected Swiss 3T3 cells was isolated and hybridized with a radioactively labeled luciferase cDNA probe The detected luciferase mRNA band ... cytoskeleton and translational apparatus J Cell Sci 111, 183–197 12 Szabo, A. , Dalmau, J., Manley, G et al (1992) HuD, a paraneoplastic encephalomyelitis antigen, contains RNA-binding domains and is homologous...
- 16
- 754
- 0
Blindsided Why the Left Tackle Is Overrated and Other Contrarian Football Thoughts doc
Ngày tải lên :
08/03/2014, 20:20
... running back (Larry Csonka) is a partial indicator that Miami wasn’t quite as strong as the other dynasty candidates of that era Add those reasons up and I simply couldn’t find a way to justify assigning ... 11 sacks, while the best pass rusher, Derrick Burgess, totaled 16 sacks This means that a bad left tackle can lose a team as many games as a great pass rusher can win That poor tackle play can ... gaps In addition, free agency and the salary cap can adversely affect the dynastic candidate’s competition if they don’t manage greed and inflated player value well Having said that, I have a...
- 275
- 637
- 0
What Is the Cognitive Neuroscience of Art… and Why Should We Care? ppt
Ngày tải lên :
23/03/2014, 13:20
... landscape paintings would not activate the parahippocampal place area and that facial portraits not activate the fusiform face area, parts of the brain that respond to photographs of landscapes ... conversations provide ample occasions for mutual learning, weaving between the theoretical and the empirical, research and application, and market pragmatics and social idealism As well as an international ... between AE and evaluation? What is the articulation of the natural and cultural bases of AE? Has AE the same properties occurring with natural phenomena, cultural artefacts, works of art? How old is...
- 20
- 801
- 0
báo cáo hóa học: " Concurrent hippocampal induction of MHC II pathway components and glial activation with advanced aging is not correlated with cognitive impairment" ppt
Ngày tải lên :
19/06/2014, 22:20
... centrifugation at 275 × g for and scanned and digitized using a Bead Station Bead Array Reader Arrays were quality control checked, and initial data analysis using average normalization with background ... rats This approach enabled visualization of age-related changes in GFAP immunoreactivity as well as assessment of potential changes in localization of astrocytes associated with aging and cognitive ... increased astrocyte activation rather than proliferation Morphological assessment also revealed an activated astrocytic phenotype associated with the aged hippocampus (Figure 5) In adult rats, astrocytes...
- 21
- 443
- 0
Báo cáo toán học: "Flexible Color Lists in Alon and Tarsi’s Theorem, and Time Scheduling with Unreliable Participants" pot
Ngày tải lên :
08/08/2014, 11:20
... rounds/days, in such a way, that each player is allowed to be unavailable on one day Each player has to announce the day of his absence in advance If player A is not available on Sunday and player ... are 3-paintable Proof Every planar graph G is contained in a triangulation with 3|V | − edges, and we have to remove at least one third of the edges (at least one edge from each triangular face) ... enough) What dose this mean? Again, it means that our tournament can be organized on seven days, in such a way, that each player is allowed to miss one day The new thing is that the players not have...
- 18
- 190
- 0
Báo cáo y học: "A combination of autoantibodies to cyclic citrullinated peptide (CCP) and HLA-DRB1 locus antigens is strongly associated with future onset of rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 01:23
... M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes of PADI4, encoding ... factors In this study, calculations are based on the combination of SE and the analysed autoantibodies This is because anti-CCP antibodies and RFs are significantly associated, and consequently ... rheumatoid arthritis: an application of the Risch theory Genet Epidemiol 1993, 10:311-320 Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki...
- 6
- 364
- 0
Báo cáo y học: " What is MRI bone oedema in rheumatoid arthritis and why does it matte" ppt
Ngày tải lên :
09/08/2014, 08:23
... hands remain normal Arthritis Rheum 2004, 50:2094-2102 21 Tamai M, Kawakami A, Takao S, Uetani M, Arima K, Tanaka F, Fujikawa K, Aramaki T, Iwanaga N, Izumi Y, et al.: Bone marrow oedema determined ... rheumatoid arthritis reveals bone oedema at the bases of the 2nd and 3rd metacarpals and adjacent regions of trapezoid and capitate carpal bones Small intraosseous erosions are also apparent the influence ... evidence at one and six years after disease onset [15,16] that bone oedema was a pre-erosive lesion The bone oedema score at presentation and one year later was correlated with radiographic erosion and...
- 5
- 440
- 0
Báo cáo y học: " Food assistance is associated with improved body mass index, food security and attendance at clinic in an HIV program in central Haiti: a prospective observational cohort study" docx
Ngày tải lên :
10/08/2014, 05:21
... Sub-Saharan Africa and North America: a meta-analysis JAMA 2006, 296(6):679-90 37 Bassett I, Wang B, Chetty S, et al: Loss to care and death before antiretroviral therapy in Durban, South Africa ... sensitivity analysis was performed using an alternate method for imputing missing data Using the E-M algorithm at and 12 months [39], food assistance was associated with better BMI (P = 0.020 and P ... by clinic staff In addition to medical care, attention is paid to the socioeconomic causes and contributors to disease and ill-health, and social assistance programs make small grants for commerce...
- 8
- 438
- 0
Is reporting on interventions a weak link in understanding how and why they work? A preliminary exploration using community heart health exemplars docx
Ngày tải lên :
11/08/2014, 05:21
... Foundation of Canada and the Canadian Institutes of Health Research), Dr Kothari (Career Scientist Award from the Ontario Ministry of Health and Long Term Care) and Dr Edwards (Nursing Chair funded ... with professional opinion leaders and published in easily understandable form for the local population This served as a great force for winning commitment from key decision makers, and motivating ... implementation models that allow for contextual adaptation and feedback processes, and mixed methods designs that guide the integrative analysis of quantitative and qualitative findings These all bring into...
- 12
- 198
- 0
Báo cáo y học: " Young adult obese subjects with and without insulin resistance: what is the role of chronic inflammation and how to weigh it non-invasively" docx
Ngày tải lên :
11/08/2014, 08:22
... defined as the thickness between the skin-fat interface and the linea alba, and the VAT was defined as the distance between the anterior wall of the aorta and the internal face of the recto-abdominal ... for ethical and technical issues For this reason, we generally speak of hepatic steatosis (HS) MS is associated with a prothrombotic and proinflammatory state Among other biomarkers, C-reactive ... other Authors disagree [5] Both SAAT and VAT can be easily and repeatedly measured by ultrasonography (US) for assessment of central obesity [6,7] Furthermore, US is widely used to detect NAFLD, without...
- 6
- 542
- 0
Báo cáo y học: "Circulating surfactant protein -D is low and correlates negatively with systemic inflammation in early, untreated rheumatoid arthritis" pps
Ngày tải lên :
12/08/2014, 12:20
... and the acquisition and interpretation of data AFC performed the statistical analysis AFC, PJ and GL drafted the manuscript KJ carried out the immunoassays and gel filtration chromatography AGJ ... Combination treatment with methotrexate, ciclosporine, and intraarticular betamethasone compared with methotrexate and intraarticular betamethasone in early active rheumatoid arthritis Arthritis ... inverse association between SP-D and disease activity measures and by the gradual SP-D increase during treatment The inverse association of SP-D and inflammatory signs and the lack of association between...
- 9
- 256
- 0
Báo cáo y học: "CD23+/CD21hi B-cell translocation and ipsilateral lymph node collapse is associated with asymmetric arthritic flare in TNF-Tg mice" potx
Ngày tải lên :
12/08/2014, 17:22
... showed that both expanding and collapsed PLN A and ILN have a similar three-fold increase in total B-in numbers vs aged matched WT controls Moreover, this increase was disease specific, as no differences ... arthritis disease activity measures and juvenile arthritis disease activity scores in polyarticular-course juvenile idiopathic arthritis: Analysis of their ability to classify the American College ... in Materials and methods The B-in population was quantified from the B220+/IgM+ fraction based on CD21 and CD23 staining, as illustrated by representative histograms of ipsilateral PLN (A) , and...
- 12
- 178
- 0
Báo cáo y học: "Host proteins interacting with the Moloney murine leukemia virus integrase: Multiple transcriptional regulators and chromatin binding factors" pot
Ngày tải lên :
13/08/2014, 05:20
... Subarna Bhattacharyya and David Lim for plasmids We also thank Kenia de los Santos and Martha De Los Santos for technical assistance BS was supported by the Howard Hughes Medical Institute and a ... Yudate HT, Masuho Y, Murakami Y, Tamura TA, Muramatsu MA: A novel TATA-binding proteinbinding protein, ABT1, activates basal transcription and has a yeast homolog that is essential for growth ... β-galactosidase activity [92] Blue colonies were isolated and streaked to fresh SC-His-Leu plates and lifted onto nitrocellulose membranes and assayed again in the X-gal colony lift assay One-half...
- 23
- 184
- 0
Báo cáo y học: " State of the Art: Why do the lungs of patients with cystic fibrosis become infected and why can''''t they clear the infection?" pps
Ngày tải lên :
13/08/2014, 13:20
... than it is in patients with bronchiectasis of other causes, such as post-infectious bronchiectasis or bronchiectasis associated with primary ciliary dyskinesia Many patients with bronchiectasis ... prolonged and vigorous antibiotic and airway clearance therapy This aspect of the disease has long provided an inviting therapeutic target, though it is essentially a rear guard action which delays ... Jaffar-Bandjee MC, Lazdunski A, Bally M, Carrere J, Chazalette JP and Galabert C: Production of elastase, exotoxin A and alkaline protease in sputa during pulmonary exacerbation of cystic fibrosis...
- 12
- 357
- 0