treatment using a daily epi and correction protocol

Báo cáo khoa học: "Cell death by the quinoxaline dioxide DCQ in human colon cancer cells is enhanced under hypoxia and is independent of p53 and p21" pdf

Báo cáo khoa học: "Cell death by the quinoxaline dioxide DCQ in human colon cancer cells is enhanced under hypoxia and is independent of p53 and p21" pdf

... DNA damage checkpoint: ATM and DNA-PK Signal transduction, induced by the activation of ATM, can cause cell-cycle arrest, repair, and cell death ATM plays a critical role in S and G2-M phase arrest ... chemotherapeutic drugs and hypoxia [15] If DNA damage is severe, the initiator caspase-2 is activated This caspase possesses a caspase recruitment domain (CARD) that allows it to interact with PIDD Caspase-2 ... testing Acknowledgements We thank Dr Youssef Mouneimne and Ms Rania El-Osta, members of the Kamal Shair Central Research Science Laboratory, for their valuable help with data acquisition and analysis...

Ngày tải lên: 09/08/2014, 09:20

13 268 0
Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

Báo cáo khoa học: The in vitro effects of CRE-decoy oligonucleotides in combination with conventional chemotherapy in colorectal cancer cell lines potx

... SDS/PAGE (15% acrylamide) distributed as established by Shapiro–Wilk testing, and parametric analyses were used throughout Differences between variables and control cultures, as determined by analysis ... ice-cold NaCl/ Pi prior to assessing the percentage of cells staining positive for SA-b-gal activity by light microscopy Statistical analysis All statistical analyses were performed using MINITAB version ... 10 (State College, PA, USA) Data was normally Combination with other chemotherapeutic agents Preliminary experiments indicated that SW620 cells were resistant to both CDO and chemotherapy at the...

Ngày tải lên: 07/03/2014, 15:20

9 331 0
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx

... receptor-mediated signal transduction Proc Natl Acad Sci USA 87, 7722–7726 Sloan-Lancaster, J & Allen, P.M (1996) Altered peptide ligandinduced partial T cell activation: molecular mechanisms and role ... 7.5] and exhaustively dialysed against buffer A to remove imidazole Assay of radioactivity incorporation Analysis of the phosphorylation of His-cTCRf using on-line LC-MS A 1.6-mL reaction was prepared, ... Spectra were processed and analysed using VNMR The phosphorylation was investigated by incubating a range of concentrations of each ITAM peptide with recombinant GST–Lck, [c-32P]ATP and unlabelled...

Ngày tải lên: 08/03/2014, 02:20

8 571 0
Báo cáo khoa học: Protein folding and disulfide bond formation in the eukaryotic cell pptx

Báo cáo khoa học: Protein folding and disulfide bond formation in the eukaryotic cell pptx

... [17,18] Two yeast PDI structures, a ‘twisted U’ and an ‘open boat’, are related by large-scale conformational changes, and provide snapshots of how the protein might bind substrates and interact with ... be targeted to membranes post-translationally [25] Vesicle-associated membrane protein-associated protein-B (VAP-B) has a role in vesicle trafficking, and the mutation P56S in VAP-B can cause ... proteins in the ER and facilitate the upregulation of ER chaperones E van Anken, from P Walter’s laboratory (San Francisco, CA, USA), described how yeast has been used as a model to visualize Ire1p...

Ngày tải lên: 29/03/2014, 22:21

7 358 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx

... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer...

Ngày tải lên: 18/06/2014, 22:20

10 618 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... NC_000077 5'-AAACACAGCTTAAAATAAAACAAAGAGGACGTGAGG-3' 5'-CAACTACAGAATCGGCGTGTGCCA-3' 5'-TCACGTGCTGTTATAATGTTGTTAAGCAGAAGATTCACGTCC-3' 3A) was less potent than that induced hypoxia (Fig 1) Therefore, ... (5'-AAGCAGATTTGGTACCCTTAGTCTTGCTTTAACGCTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACAAGGCTGCT-3') was generated by genomic PCR using a pair of primers (5'-ggggtacc ATCCAAGCAGATTTGGTACCCTTAGTCTTGCTTT-3', and 5'-gaagatctGAGCAGC ... MCP-1: GenBank Accession # AY357296 5'-GACCATCCAAGCAGACGTGGTA CCCACAGTCT TGCTTTAACG CTACTTTTCC AAGATAAGGT GACTCAGAAA AGGACAAGGG GTGAGCCCAA CCACACAGCTGC-3' MCP-5: GenBank Accessions # AC012294,...

Ngày tải lên: 19/06/2014, 22:20

15 541 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt

... Nishioka C, Tasaka T, Taniguchi A, Kuwayama Y, Komatsu N, Bandobashi K, Togitani K, Koeffler HP, et al: AZD1152, a novel and selective aurora B kinase inhibitor, induces growth arrest, apoptosis, and ... study and performed the statistical analysis YD, MAH, CM conceived of the study, and participated in its design and coordination and helped to draft the manuscript All authors read and approved ... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell line-based platforms to evaluate the therapeutic efficacy of candidate anticancer agents Nat Rev Cancer...

Ngày tải lên: 20/06/2014, 04:20

10 665 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" pptx

... Niida S, Kaku M, Amano H, Yoshida H, Kataoka H, Nishikawa S, Tanne K, Maeda N, Nishikawa S, Kodama H: Vascular endothelial growth factor can substitute for macrophage colony-stimulating factor ... experimental studies SM, KH and AS participated in the design of the study and performed the data analysis YI participated in its design and helped to draft the manuscript All authors read and approved ... Matsumoto Y, Tanaka K, Hirata G, Hanada M, Matsuda S, Shuto T, Iwamoto Y: Possible involvement of the vascular endothelial growth factor-flt-1-focal adhesion kinase pathway in chemotaxis and the cell...

Ngày tải lên: 20/06/2014, 04:20

8 445 0
báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx

báo cáo hóa học:" Role of the VEGF-Flt-1-FAK pathway in the pathogenesis of osteoclastic bone destruction of giant cell tumors of bone" potx

... Niida S, Kaku M, Amano H, Yoshida H, Kataoka H, Nishikawa S, Tanne K, Maeda N, Nishikawa S, Kodama H: Vascular endothelial growth factor can substitute for macrophage colony-stimulating factor ... experimental studies SM, KH and AS participated in the design of the study and performed the data analysis YI participated in its design and helped to draft the manuscript All authors read and approved ... Matsumoto Y, Tanaka K, Hirata G, Hanada M, Matsuda S, Shuto T, Iwamoto Y: Possible involvement of the vascular endothelial growth factor-flt-1-focal adhesion kinase pathway in chemotaxis and the cell...

Ngày tải lên: 20/06/2014, 07:20

8 244 0
Báo cáo khoa học: " Loratadine dysregulates cell cycle progression and enhances the effect of radiation in human tumor cell lines" pot

Báo cáo khoa học: " Loratadine dysregulates cell cycle progression and enhances the effect of radiation in human tumor cell lines" pot

... a narrow band to facilitate quantification Quantification was done by densitometry using a FluorChem gel documentation system (Alpha Innotech, San Leandro, CA) and AlphaEaseFC software (Alpha ... increased DNA fragments in irradiated and loratadine-treated cells (C) Loratadine alone induced DNA fragmentation and an additional band corresponding to smaller DNA fragments (arrow) The graph ... hrs Loratadine-treated irradiated cells demonstrated increased and persistent DNA fragmentation and an additional band corresponding to smaller DNA fragments (arrows) (B) Densitometry analysis...

Ngày tải lên: 09/08/2014, 10:20

12 405 0
báo cáo khoa học: "EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pptx

báo cáo khoa học: "EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pptx

... published All authors read and approved the final manuscript Competing interests We declare that we have no financial and personal relationships with other people or organizations that can inappropriately ... immunohistochemical assay Activation of the EGFR results in activation of downstream signaling pathways, including the Ras-Raf-MKKextracellular signal-regulated kinase (ERK) and lipid kinase phosphatidylinositol ... human non-small cell lung cancer cells Mol Cancer Ther 2008, 7(11):3632-3641 15 Akashi Y, Okamoto I, Iwasa T, Yoshida T, Suzuki M, Hatashita E, Yamada Y, Satoh T, Fukuoka M, Ono K, Nakagawa K:...

Ngày tải lên: 10/08/2014, 10:21

8 435 0
báo cáo khoa học: " Correction: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pps

báo cáo khoa học: " Correction: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features" pps

... West China Hospital, Sichuan University, PR China 2Department of Pathology, West China Hospital, Sichuan University, PR China Table (corrected table five) COX-2 expression in tumor and paracancerous ... Huijiao, Liao Dianying, Shen Yali, Xu Feng, Wang Jin: EGFR and COX-2 protein expression in non-small cell lung cancer and the correlation with clinical features Journal of Experimental & Clinical ... Li et al Journal of Experimental & Clinical Cancer Research 2011, 30:32 http://www.jeccr.com/content/30/1/32 Table (corrected table 3) EGFR expression and clinical characteristics Page of Table...

Ngày tải lên: 10/08/2014, 10:21

2 287 0
báo cáo khoa học: "ShRNA-mediated gene silencing of MTA1 influenced on protein expression of ER alpha, MMP-9, CyclinD1 and invasiveness, proliferation in breast cancer cell lines MDA-MB-231 and MCF-7 in vitro" pptx

báo cáo khoa học: "ShRNA-mediated gene silencing of MTA1 influenced on protein expression of ER alpha, MMP-9, CyclinD1 and invasiveness, proliferation in breast cancer cell lines MDA-MB-231 and MCF-7 in vitro" pptx

... CTGTCAGTCTGCTATAATTCAAGAGATTATAGCAGACTGACAGGGTT GCGG-3’, antisense: 5’-GATCC CGCAACCCTGTCAGTCTGCTATAATCTCTTGA ATTATAGCAGACTGACAGGGTTGCTTTTTA-3’, the second pair:sense:5’-AGCTT AAAAAGGCAGACATCACCGACTTGTTAATTCAAGAGATTAACAAGT CGGT GATGTCTGCCGG-3’, ... bp and 529~551 bp for MTA1 The first pair sense:5’-GCAACCCTGTCAGTCTGCTATAA-3’, and anti-sense: 5’-TTATA GCAGACTGACAGGGTTGC-3’, the second pair: sense:5’-GGCAGACATCACCGA CTT GTTAA-3’, and antisense:5’-TTAACAAGTCGGTGA ... fragment, specificity of constructed oligonucleotides fragments were analyzed by BLAST The sequence as follow, the first pair:sense:5’-AGCTTAAAAAG CAACC CTGTCAGTCTGCTATAATTCAAGAGATTATAGCAGACTGACAGGGTT...

Ngày tải lên: 10/08/2014, 10:21

11 281 0
Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

Báo cáo khoa học: " Herpes simplex virus type 1 and normal protein permeability in the lungs of critically ill patients: a case of low pathogenicity" docx

... Ishizaka A, Hasegawa N, Nakamura K, Takagi Y, Takano M, Yamaguchi K, Kubo A: Usefulness of pulmonary vascular leakiness assessment in interstitial pneumonitis Chest 2001, 119:14551460 22 Murray ... radioactivity ratio represents the ratio of extravascular to intravascular 67Ga radioactivity The PLI represents the transport rate of 67Ga-transferrin from the intravascular to the extravascular ... For each blood sample, a timematched CPM over each lung was measured A radioactivity ratio was calculated – (67Galung/99mTclung)/(67Gablood/99mTcblood) – and plotted against time The PLI was calculated,...

Ngày tải lên: 12/08/2014, 20:20

6 284 0
Unit 1: A day in the life of. Listening

Unit 1: A day in the life of. Listening

... Listen and order these pictures WHILE-LISTENING Listen again and decide whether the statements are True (T) or False (F) Mr Lam lives in District Mr Lam usually gets up early After Mr Lam gets ... WARM UP Game: JUMBLED WORDS CCLOY  CYCLO RIEDV  DRIVE TALLS DOFO  FOOD STALL NSSEGERPA  PASSENGER PRE-LISTENING WHO IS HE? - He gets up very early - He has got a cyclo - He usually has meals ... to District Mr Lam’s first passengers are two pupils Mr Lam has lunch at home with his family After lunch Mr Lam immediately goes back to work T F POST-LISTENING V HOMEWORK - T asks ss to remember...

Ngày tải lên: 21/06/2013, 01:26

10 12,6K 39
Unit 1-A day in the life of...

Unit 1-A day in the life of...

... Read the passage and find all the verbs that are used in past simple and the connectors in the story Simple past Regular verbs land stare announce Irregular verbs take begin S + Ved landed stared ... A day in the life of Period 4: Writing Task Task 3.Task 3: Example: Last year/ I / spend / summer holidays / a seaside town Last year, I spent my summer holidays at a seaside town Unit 1: A ... 1: A day in the life of Last year, I spent Period 4: Writing at a my summer holidays seaside town The hotel was modern and Task comfortable I had a wonderful holiday until the fire Task Task...

Ngày tải lên: 18/09/2013, 05:10

20 2,8K 5
Gián án Ụnit 1: A day in the life of...

Gián án Ụnit 1: A day in the life of...

... is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities in a day in m -after m t call on some ... remember activities and time’s activities of Linh -2 ms for teams go to the board and write answers -team which more correct answer is winner * checking instruction (p.) *after ms T check answers and ... Stage / timing Prereading 5ms Activities warm-up GUESS THE ACTIVITIES * Instruction: -Divide class in to two teams: team A & team B -Show a video about linh’ daily routine in minute -ask ss...

Ngày tải lên: 02/12/2013, 19:11

3 2,1K 12
Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf

Tài liệu Activity 5.1: Identifying Keys in the Logical Model pdf

... MaintenanceCost1 MaintenanceDesc1 MaintenanceDate1 MaintenanceMiles1 MaintenanceCost2 MaintenanceDesc2 MaintenanceDate2 MaintenanceMiles2 MaintenanceCost3 MaintenanceDesc3 MaintenanceDate3 MaintenanceMiles3 ... Ferguson and Bardell, Inc case study ! Specify the keys in a logical data model Review the ER diagram on the next page Identify the areas of the ER diagram for which keys are necessary Write ... Timesheet Name Address SSN E-Mail Type Salary BillableRate ∞ Completes Invoice EmployeeFirstName EmployeeLastName ClientName ClientLocation Date Expenses TotalHours BillableHours Description ClientName...

Ngày tải lên: 21/12/2013, 06:16

4 391 0
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx

... was frozen at )80 °C Purification of hMS Human MS was purified by ion exchange and cobalamin affinity chromatography, following a modified protocol of Yamada et al [14] Cobalamin–agarose was prepared ... recombinant hMS is expressed as an apoenzyme in P pastoris at levels that enable purification of sufficient quantities for functional analysis (Table 1) A clear advantage of using Pichia as a heterologous ... temperature was maintained at 29 °C, and agitation was constant at 900 r.p.m A pH of 5.0 was maintained using 14% (w ⁄ v) ammonium hydroxide The glycerol batch phase was run until glycerol was completely...

Ngày tải lên: 18/02/2014, 08:20

10 699 0
w