treatment of a malpositioned implant in the esthetic zone

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc

... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C ... molecules may still rely on the SecB pathway, because of overloading of the SRP pathway The re-routing of (G-10L)prePhoE to the Sec translocon via the SRP instead of the SecB pathway could be explained...

Ngày tải lên: 08/03/2014, 09:20

8 547 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot

... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... pathway [5] The binding of divalent cations by the decarboxylase precludes metal binding studies of the hydratase in that complex In this study, BphH, the hydratase in the PCBs degradation pathway ... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada)...

Ngày tải lên: 30/03/2014, 15:20

9 461 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of...

Ngày tải lên: 07/08/2014, 03:22

12 386 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc

Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc

... class reduction (AGC single value) Abrupt growth change mean curve (AGCm curve) was based on annual values and was the mean of all AGC single values of all bog pines of the transect, using the ... (LV3) The basal area of Norway spruce increased from the wettest subplot towards the drier ones at the edge of the bog For the living bog pines, the maximum basal area was found in the middle of the ... used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) Based on the...

Ngày tải lên: 08/08/2014, 01:21

10 277 0
báo cáo khoa học: "Vaginal treatment of endometrial cancer: role in the elderly" doc

báo cáo khoa học: "Vaginal treatment of endometrial cancer: role in the elderly" doc

... underwent a total vaginal hysterectomy with bilateral salpingo-oophorectomy at a time that included a vaginal margin being at least 1,5 and maximum cm Anesthesiologists always performed a spinal anesthesia ... rates Avoiding a major abdominal surgery and general anesthesia is highly remarkable Less invasive approaches as laparoscopy have today shown an evidence-based equal treatment efficacy for early ... outcome in selected patients We compared the clinical outcome of the vaginal versus the abdominal hysterectomy in a population of elderly patients as treatment for endometrial cancer at an early stage...

Ngày tải lên: 09/08/2014, 02:20

6 221 0
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps

Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps

... T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T ... discovery of a SNP that adds an extra cysteine into the amino acid sequence of leptin, combined with a signicant association to carcass fat measurements and signicant variation in the level of mRNA detected ... hypothesized that the amino acid change from arginine to cysteine is imparting a functional difference to the leptin molecule One explanation may be that the cysteines presence in the A- helix of...

Ngày tải lên: 09/08/2014, 18:21

12 321 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... vascular anastomosis taking place after the migration of the primordial germ cells to the site of the primitive gonad had finished, a mechanism which has been previously suggested to explain the ... 100 fetal calf serum, p 100 phytohemaglutinin M (Difco), 100 LU of penicillin and 100 mg/ml of streptomycin The metaphases were conventionally stained in Giemsa and 15 analysed for each animal III...

Ngày tải lên: 09/08/2014, 22:22

5 319 0
Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc

Báo cáo y học: "Ultrasound in the diagnosis of a median neuropathy in the forearm: case report" doc

... anatomic abnormalities [3,5] This case demonstrates that it may be valuable in establishing an anatomic etiology and directing appropriate management in a diagnostically challenging case of median ... subsequent healing It has been shown that HRUS may be used as an adjunct to physical examination and electrodiagnostic findings in the diagnosis of nerve entrapment neuropathies in the absence of anatomic ... neuropathy in the forearm In addition, ultrasound is non-invasive, inexpensive, and effective as a pre-operative planning tool for the surgical treatment of focal neuropathies Page of (page number...

Ngày tải lên: 10/08/2014, 10:20

4 372 0
báo cáo khoa học: "Necrotizing sialometaplasia as a cause of a nonulcerated nodule in the hard palate: a case report" pot

báo cáo khoa học: "Necrotizing sialometaplasia as a cause of a nonulcerated nodule in the hard palate: a case report" pot

... with stabbing pain in the absence of clinical alterations of the mucosa These findings are important for the clinician, who must be aware that a swelling in the palate may not be an inflammatory ... [2,3] In the present case, the biopsy was obtained at an early stage of the disease, a fact that may explain the absence of an ulcer Squamous metaplasia of the ductal epithelium, accompanied ... necrosis of glandular acini, an inflammatory response, pseudoepitheliomatous hyperplasia of overlying epithelium, and maintenance of the lobular architecture [2-5,7,8] Ductal squamous metaplasia and...

Ngày tải lên: 10/08/2014, 23:20

3 373 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious ... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... shown in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
Báo cáo y học: "Open Access Torsion of a normal ovary in the third trimester of pregnancy: a case report" docx

Báo cáo y học: "Open Access Torsion of a normal ovary in the third trimester of pregnancy: a case report" docx

... provisional diagnosis of appendicitis was made Laparotomy was conducted through a grid-iron incision The appendix was normal in appearance Minimal bloodstained peritoneal fluid was noted on opening the ... publication of this case report and accompanying images A copy of the written consent is available for review by the Editor -in- Chief of this journal Competing interests The authors declare that they have ... competing interests AS was involved in the management of the case and wrote the manuscript draft VG conducted the literature research and revised the manuscript References The patient experienced an...

Ngày tải lên: 11/08/2014, 19:21

2 341 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal...

Ngày tải lên: 11/08/2014, 21:22

4 342 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx

... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... TCGTCCGTCAGTAGCCACGTACAGTATC CACAAAACCAAAACTTCACATCCCATCC CTCACTATGGATTCTCCTAGCGGTGTCG Page 10 of 13 (page number not for citation purposes) BMC Plant Biology 2009, 9:30 μg protein was incubated in presence of...

Ngày tải lên: 12/08/2014, 03:20

13 650 0
Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx

Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx

... of these areas may be the xenotransplantation of porcine tissues and organs to humans Xenotransplantation is a potential solution for the shortage of allogeneic human organs Designated pathogen-free ... material for PERV transmission found no viral DNA [18] However, three of the patients showed a clear antibody response against the p27Gag of PERV in a Western blot assay, and a small percentage of ... and in melanoma-bearing animals, and recombinant PERV -A/ C was characterized by high replication titers [20-22] Whether XMRV and PERV recombine remains unclear, however co-packaging [23] and pseudotyping...

Ngày tải lên: 12/08/2014, 23:23

3 290 0
Báo cáo y học: "Theoretical analysis of the mechanisms of a gender differentiation in the propensity for orthostatic intolerance after spaceflight" docx

Báo cáo y học: "Theoretical analysis of the mechanisms of a gender differentiation in the propensity for orthostatic intolerance after spaceflight" docx

... only a variance in their longitudinal center of gravity Computer Systems Analysis of the Hypothesis The hypothesis was examined through a systems analysis approach using a derivative of a well-established ... have a lower COG [10] The graphs in the results are intended to reflect the propensity of females to have OI as a result of their population average of a lower COG A finding of a lower COG and a ... Coleman TG, Meck JV: Development of the Digital Astronaut Program for the Analysis of the Mechanisms of Physiologic Adaptation to Microgravity: Validation of the Cardiovascular System Module Acta...

Ngày tải lên: 13/08/2014, 16:20

8 337 0
Báo cáo y học: "A day in the life of a genome biologist in the not-too-distant future" pdf

Báo cáo y học: "A day in the life of a genome biologist in the not-too-distant future" pdf

... overthrow of capitolism (HAVOC) Act of 2011 made it illegal for journals to reject papers or to make a profit, all journals now accept all papers automatically so paper was immediately accepted by all ... scientists have had the right to submit their papers simultaneously to as many journals as they like, and to have the same paper published in up to five journals at once.) Since the Harold Varmus overthrow ... trans-fat sandwich on tobacco leaf bread Paused to reflect how amazing that earlier generations of scientists actually considered this unhealthy - exactly the opposite of what careful research has...

Ngày tải lên: 14/08/2014, 18:20

2 438 0
treatment of cross-cultural characteristics in the teaching of speaking to grade 12a1 students of english in nam dan 1 high school in nghe an province = xử lý các yếu tố giao văn hóa trong giờ dạy nói tiếng anh

treatment of cross-cultural characteristics in the teaching of speaking to grade 12a1 students of english in nam dan 1 high school in nghe an province = xử lý các yếu tố giao văn hóa trong giờ dạy nói tiếng anh

... perplexities For example, the students at Vinh university complained about an American professor that their American teachers often eat bread and drink milk on the table of the teacher in break and she ... language teaching and learning, it is essential that language teachers should pay more attention to teaching speaking skills Teaching speaking is a very important part of second language learning The ... language, meaning and expression develop together Today educators have become aware of the importance of cultural factors in the teaching of speaking skills and they also see the influence of inferences...

Ngày tải lên: 28/02/2015, 11:54

69 1,1K 2
The ABC protocol in the esthetic zone   a comprehensive surgical and  prosthetic approach

The ABC protocol in the esthetic zone a comprehensive surgical and prosthetic approach

... Mix) An impression of the opposing arch was made and a cast was fabricated Maximum intercuspation was chosen as the maxillomandibular relationship of treatment A cementretained single implant ... seconds A crestal incision was made, extending intrasulcularly on the facial aspect of the central incisor and canine teeth The papilla between the canine and irst premolar was preserved and a vertical ... iduciary markers A CT scan was taken of the patient with the appliance seated intraorally The The International Journal of Periodontics & Restorative Dentistry Digital Imaging and Communications in...

Ngày tải lên: 05/07/2016, 17:15

10 410 0
w