treatment and replacement of a malpositioned implant in the esthetic zone
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... the biosynthesis and accumulation of CGA [25] On the other hand, a lowered HCT expression in tobacco [29], Pinus radiata [30] and Medicago sativa [31] changes lignin amount and composition, thereby...
- 13
- 650
- 0
Báo cáo y học: "Efficacy and safety of non-invasive ventilation in the treatment of acute cardiogenic pulmonary edema – a systematic review and meta-analysis" docx
... using any device) and medical therapy compared with standard medical therapy alone; use of NPPV (with any device) and medical therapy compared with standard medical therapy alone; or use of CPAP ... Poulton and colleagues [65] more than 60 years ago, and seven years ago the first meta-analysis appeared, showing the efficacy of CPAP in the treatment of ACPE [10] Since then, several RCTs comparing ... congestive heart failure) and (clinical and trial or clinical trials or clinical trial or random* or random allocation or therapeutic use) Literature searches were also undertaken, using the same search...
- 18
- 422
- 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc
... and as the capital and credit of the Bank increased, they continued to gain an increasing circulation Previous to the year 1796, that circulation was generally about equal in amount to the capital ... facilitate this new branch of traffic As a natural consequence of the issue of all this paper the coin was rapidly leaving the kingdom; this circumstance alarmed the managers of the bank; and as the ... privilege of farming all the taxes and the whole revenue of the kingdom; and presently bought out the mint, and the right of coinage, lor a sum of money paid to the king Finally the Company advanced...
- 78
- 775
- 0
Báo cáo khoa học: Determination of the metal ion dependence and substrate specificity of a hydratase involved in the degradation pathway of biphenyl/chlorobiphenyl pot
... Ontario, Canada) or New England Biolabs (Pickering, Ontario, Canada) All other chemicals were of analytical grade and were obtained from Sigma-Aldrich and Fisher Scientific (Nepean, Ontario, Canada) ... substrate Therefore, the metal ion has a catalytic rather than just a substrate binding role Possible roles of the cation include the activation of water for the hydration reaction and ⁄ or the stabilization ... from the National Science and Engineering Research Council of Canada S Seah thanks the Canadian Foundation for Innovation and Ontario Innovation Trust for infrastructure support We thank Valerie...
- 9
- 461
- 0
Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt
... emerge Data was then subject to qualitative and semi-quantitative analysis as appropriate This approach complements the intricate and unique nature of each farmer’s reaction, and allows for further ... (Can Tho and An Giang) of the four major catfish farming provinces in the Mekong Delta, but also included surveys of other BMP farmers and some non BMP farmers in the other major provinces of the ... larger farmers and/ or processors (as part of expansion of ‘industrial scale’ farming) due to market pressures, such as increasing cost of inputs and declining fish price, and other farms have simply...
- 36
- 414
- 0
Báo cáo khoa hoc:"Association of a missense mutation in the bovine leptin gene with carcass fat content and leptin mRNA levels" pps
... T A A - A T T A G C T G A C A A A A C C T A A A G T C C A G C C C A A A A C A A T A A A C T A A T C C C C T C C A C C C C A T T A C C C C A A A A C T T C A C C A A A A G G A A C C A A A A T T ... discovery of a SNP that adds an extra cysteine into the amino acid sequence of leptin, combined with a signicant association to carcass fat measurements and signicant variation in the level of mRNA detected ... breeds (Angus and Hereford) are characterized by their early maturity as compared to continental breeds (Charolais and Simmental), giving them the capacity to carry more fat at a younger age [10]...
- 12
- 321
- 0
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... While there are many differences in the molecular and genetic details of the circadian machinery in mammals and Drosophila, the basic regulatory principles are maintained [20,21] Central to the ... forward 5'-GTGAACGCCGTGCACTGGTTCCGAAAGGGAC-3', mCry1 reverse 5'GTCATGATGGCGTCAATCCACGGGAAGCCTG-3'; mPer2 forward 5'-GATCAGCTGCCTGGACAGTGTCATCAGGTACC-3', and mPer2 reverse 5'-CTGAGCGTCGAGGTCCGACTAGGGAACTCAGCC-3' ... participated in the design of the study, and drafted the manuscript BD generated the RNAi GSK3 mutant lines (A1 .4 and A1 .6), generated the c2.1 3/4 DKO mutant, and carried the clonal Western analysis...
- 12
- 377
- 0
Báo cáo y học: " Detection of a gammaretrovirus, XMRV, in the human population: Open questions and implications for xenotransplantation" ppsx
... and in melanoma-bearing animals, and recombinant PERV -A/ C was characterized by high replication titers [20-22] Whether XMRV and PERV recombine remains unclear, however co-packaging [23] and pseudotyping ... material for PERV transmission found no viral DNA [18] However, three of the patients showed a clear antibody response against the p27Gag of PERV in a Western blot assay, and a small percentage of ... of these areas may be the xenotransplantation of porcine tissues and organs to humans Xenotransplantation is a potential solution for the shortage of allogeneic human organs Designated pathogen-free...
- 3
- 290
- 0
Adoption, use and diffusion of online social networks in the older population : a UK perspective
... following reasons Firstly, the population of the UK is ageing in terms of both the increase in the average (median) age of the population and the increase in the number and proportion of older ... examples of OSNs include Twitter, Facebook, MySpace and Linkedin OSNs dynamic updating, creating and uploading of content and interaction with other user’s Investigating the Adoption, Use and ... comparative analysis of research findings against analysis of findings derived using nationally representative datasets Summarises the research findings and provides research contributions and implications...
- 422
- 267
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 2
... matrix of pair-wise comparisons A = (aij) can be established as follows: A1 A2 An A1 a1 /a1 a1 /a2 a1 /an A2 a2 /a1 a2 /a2 a2 /an An an /a1 an /a2 an/an 149 where ai/aj = aj/ai for all ... block The calculation is based on estimates of average annual local rainfall, absorption capacity of site through permeable paving and landscaping (See 6.3.3.) All waste water in the housing block ... weights of a set of criteria (w1, w2, , wn) from that matrix The following is a brief summary of the mathematical theory of the AHP, as reference to Saaty and Vargas (1991) and Harker (1989) The matrix...
- 75
- 365
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 3
... distance of available point that horizontal and downward views are available of the interior of bedroom and living areas of certain percentage of dwelling units of the building Interpreting from ... percentage of greenery area in the site In daylight factor, other constituting components in the measurement include the total area and reflectance of interior surfaces, the total area and average ... performance, the building footprint area (Af) and the percentage of hard-paved area of the site (P) should be kept as low as possible, and the total net usable area of the building (Anet) should be as large...
- 131
- 400
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 4
... criticism and debate' (as in the words of Guy and Farmer, 2001) 329 14.3 Towards sustainable public housing in Singapore In substantiating the main discourse of environmental performance and sustainable ... potential sustainable performance of the project, based on the information available at the end of the Design phase Because the information available during the Pre-Design and Design phases are likely ... few indicators are available in this phase Assessment during the Operations phase is intended to provide an objective and factual indication of the Actual performance of the project, and the...
- 59
- 395
- 0
Environmental performance and sustainable architecture a critical review in the context of singapore public housing 1
... Conference in Canada The objective of GBC is not a commercial tool, but rather a research and testing tool acting as a generic framework for global practice and national adaptation In the words of Raymond ... sustainability; on the other hand, stiffens the evolution of understanding and definition of sustainable development, and restrains innovation of strategies towards sustainability Secondly, in ... establish a framework that integrates all these aspects of the study in approaching sustainable housing 1.5.2 Research objectives The driving force of this research is the disintegrating and...
- 113
- 271
- 0
Tài liệu SOCIAL MEDIA AND BRAND AWARENESS - A CASE STUDY IN THE FAST MOVING CONSUMER GOODS SECTOR docx
... cycle in which social media may be used, social media and branding, brand and branding in general and branding in fast moving consumer goods sector, brand strategy, brand equity and brand awareness, ... branding, and means that rather than broadcasting messages to audiences and target groups, in the era of social 10 web that we live in today, branding and marketing is about participating in ... that brand awareness has in the creation of brand equity, and that recent research take into account also how social media influence brand awareness, brand awareness is the aspect of branding...
- 54
- 684
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... obtained by P1 transduction using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial ... using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse primer (5¢-CGCGGA TCCTTTTTGCTGTCAGTATCAC-3¢), pNN7 and pNN8 as the templates, respectively, and ... [13] Quantification of the data indicated that the cross-linking efficiency of the mutant nascent chains was somewhat reduced (Fig 3B) In conclusion, our results show an increased affinity of the G-10C...
- 8
- 546
- 0
Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt
... management is a process of governance and political decision-making, geared toward the formation of partnerships and power sharing It is consensus-driven and geared toward achieving a balance of interests ... changes in historical lagoon’s utilization and management We used software tools such as Mapinfo 8.5 and Excel in order to modify maps and reckon the surveyed data And we also used the comparative ... farmer to earn additional income as well as an increasing number of participators, intensification of exploitation, higher risk of environmental degradation and rapid exhaustion of the lagoon’s...
- 11
- 528
- 0
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx
... Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern MA Table Drainage-area characteristics and mean annual flows at streamflow-gaging ... Fine to coarse sand and gravel Fine to coarse sand and gravel Sand and gravel Sand and gravel AN-06G AN-05G AN-09G AN-10G Well site Predominant grain size of tested interval [Well site: See table ... withdrawals and wastewater discharges in the Assabet River Basin, eastern Massachusetts 29 Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin,...
- 142
- 1,437
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25