trastuzumab a monoclonal antibody against the her 2 neu receptor is recommended for use in patien

Báo cáo khoa học: Probing plasma clearance of the thrombin–antithrombin complex with a monoclonal antibody against the putative serpin–enzyme complex receptor-binding site docx

Ngày tải lên : 17/03/2014, 10:20

... relative to the RCL, and is always in an orientation that blocks the binding of thrombin to AT An alternative explanation is that binding of M27 distorts the conformation of the RCL in a manner ... also argue against a major role for the FIREVP sequence in receptor- mediated complex binding We have generated and characterized a murine mAb, M27, possessing high afﬁnity for human AT This antibody ... stage amidolytic assay are shown in parentheses Vmax is the rate of substrate hydrolysis, as measured by the change in absorbance at 405 nm over a period of 20 In all cases the change was linear...

11
378
0

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Ngày tải lên : 06/03/2014, 22:21

... Pi, the membranes were incubated for h with 2% milk in NaCl ⁄ Pi containing a rabbit polyclonal antibody against Fn After several washings in NaCl ⁄ Pi-T (NaCl ⁄ Pi containing 0.5% Tween -20 ), the ... goat anti-(rabbit IgG) Monoclonal antibodies against FnBRs of FnBPB A panel of mouse mAbs was produced against the recombinant repetitive region of FnBPB Analysis of mAbs binding to the recombinant ... [22 ] and tropoelastin-binding abilities, mediated by the N-terminal A- domain region [23 ] The Fn-binding moiety is organized into 11 tandem repeats, each interacting with the NTD of Fn Six of these...

16
560
0

Báo cáo y học: "A monoclonal antibody against kininogen reduces inflammation in the HLA-B27 transgenic rat" pptx

Ngày tải lên : 09/08/2014, 06:22

... Espinola RG, Uknis A, Sainz IM, Isordia-Salas I, Pixley RA, DeLa Cadena R, Long W, Agelan A, Gaughan J, Adam A, et al.: A monoclonal antibody to high molecular weight knininogen is therapeutic in ... plasma kallikrein inhibitor attenuates acute intestinal inflammation in Lewis rat Dig Dis Sci 1996, 41:9 12- 920 29 Stadnicki A, Sartor RB, Janardham R, Majluf-Cruz A, Kettner C, Adam AA, Colman ... signs of intestinal inflammation (diarrhea) had disappeared, and the stool character remained normal or nearly normal for the duration of the experiment (Fig 2a) Histological analysis demonstrated...

8
452
0

Báo cáo y học: " HIV-1 neutralization by monoclonal antibody against conserved region 2 and patterns of epitope exposure on the surface of native viruses" pot

Ngày tải lên : 11/08/2014, 08:21

... P05877 ABY26917 AY669700 AAT675 32 219 22 0 22 1 22 2 22 3 22 4 22 5 22 6 22 7 22 8 22 9 23 0 23 1 23 2 23 3 23 4 23 5 23 6 23 7 23 8 23 9 24 0 D C2E 21 8 E P I P I H Y C T P A G Y A I L K C N D K N E F E E E ... Several MAbs against these epitopes have also been produced [23 ,24 ] The MAb against 22 2 -23 1 was reported to be reactive with a denatured form of gp 120 [24 ], whereas we demonstrated that our MAb against ... especially against subtype C isolates in this assay A low IC50 against SF1 62 was also observed in the PBMC-based assay [IC50>50 μg/ ml] (Table 2) The reason that MAb C2EB5 was able to neutralize...

8
445
0

báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx

Ngày tải lên : 18/06/2014, 15:20

... randomized phase I trial in patients with metastatic melanoma and renal cell carcinoma J Immunother 20 03, 26 :130-138 Antony PA, Paulos CM, Ahmadzadeh M, Akpinarli A, Palmer DC, Sato N, Kaiser A, Hinrichs ... related to the treatment effect, exposure to EMD 27 3063 resulted in a decrease for patients in GD2 staining on melanoma cells and increases in staining for S100 Whether this decrease in GD2 staining ... subset of patients [1 ,2] The main drawback of IL2 therapy is its toxicity, especially when administered at high doses that require hospitalization for therapy Most patients receiving the FDA-approved...

11
673
0

báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc

Ngày tải lên : 18/06/2014, 19:20

... managed the valuation survey, conducted analysis and reported on the valuation exercise *DM ran the analysis to identify items for the valuation exercise, analysed the validation data and contributed ... find it too much of an effort to speak, would be classified in health state 122 2 The corresponding value for that health state according to the recommended model is 0.465 All other health state ... comparable [25 ] The valuation exercise found that the best state defined by the CAMPHOR items was below It is clear from this and other studies that individuals valuing the best health state...

8
590
0

Báo cáo hóa học: " Development of a parent version of the Manchester-Minneapolis quality of life survey for use by parents and carers of UK children: MMQL-UK (PF)" potx

Ngày tải lên : 18/06/2014, 22:20

... PU was the primary researcher, was responsible for co-ordinating and managing the study on a day-to-day basis, for data collection and collation, data analysis and input into writing the manuscript ... methodological and statistical support throughout the study, was involved in the final study analysis and was involved in writing the manuscript AM provided clinical support for the study, was involved in ... for 12 18 and 19 25 year olds No parent form is available for the original MMQL forms The anglicised MMQL-UK (CF) version of the questionnaires (based on the 12 18 year age group) was used as the...

8
609
0

báo cáo hóa học:" Validation of a Greek version of the Oral Health Impact Profile (OHIP-14) for use among adults" pdf

Ngày tải lên : 20/06/2014, 16:20

... statistical analysis WP participated in drafting the paper and discussing the relevant literature in the OHRQoL AG contributed to the statistical analysis, YJ coordinated the original study, ... by examining the association between the OHIP-14 total score and participants’ dental status as assessed by the clinical examination Mann-Whitney or Kruskal-Wallis test was used to assess the ... life in an adult Swedish population Acta Odontol Scand 20 09, 67: 85-93 28 23 Ekanayake L, Perera I: Validation of a Sinhalese translation of the Oral Health Impact Profile-14 for use with older adults...

30
235
0

báo cáo khoa học:" Measurement properties of physical function scales validated for use in patients with rheumatoid arthritis: A systematic review of the literature" pps

Ngày tải lên : 12/08/2014, 00:20

... questionnaire scores only, rather than on individual scales, leading to indeterminate ratings for these questionnaires as well For the remaining questionnaires that were rated indeterminate, factor analysis ... have used the original version, unless stated otherwise in the article Finally, because the quality criteria used in this study require at least 50 patients per analysis to be eligible for rating, ... properties is outdated Further psychometric testing is therefore desirable Finally, the short AIMS was also rated favorably for all aspect of validity, but it contains scales that lack internal consistency,...

13
384
0

báo cáo khoa học:" Rasch analysis of the Hospital Anxiety and Depression Scale (HADS) for use in motor neurone disease" pot

Ngày tải lên : 12/08/2014, 00:20

... this population The low person separation index demonstrated by this scale suggests that it is suitable as a summary scale for research, rather than for clinical use This may have been as a result ... (which included a pair of grouped items as above) providing acceptable fit statistics (see Table HADS -A Final) Individual item fit statistics for the final HADS -A subscale are given in Table All ... of Rasch analyses across a range of diseases suggests that the performance of the HADS may vary by diagnostic group and reinforces the need for clinicians and researchers to formally test the...

8
382
0

Báo cáo khoa học: A monoclonal antibody, PGM34, against 6-sulfated blood-group H type 2 antigen, on the carbohydrate moiety of mucin doc

Ngày tải lên : 23/03/2014, 09:21

... mAb against sulfated oligosaccharide of mucin D Tsubokawa et al by a combination of galactose oxidase-cold thionin Schiff staining and paradoxical concanavalin A staining [4] This method ... stomach Am J Anat 161, 21 9 23 8 Katsuyama T, Ota H, Ishii K, Nakayama J, Kanai M, Akamatsu T & Sugiyama A (1991) In Gastrointestinal Function Regulation and Disturbances (Kasuya, Y, Tsuchiya, M, ... reaction and lectin stainings Acta Pathol Jpn 35, 1409–1 425 12 Ishihara K, Kurihara M, Eto H, Kasai K, Shimauchi S & Hotta K (1993) A monoclonal antibody against carbohydrate moiety of rat gastric...

16
296
0

Tài liệu Báo cáo khoa học: Mapping of the epitope of a monoclonal antibody protecting plasminogen activator inhibitor-1 against inactivating agents pptx

Ngày tải lên : 20/02/2014, 11:20

... 1 522 3–1 522 8 24 Jensen, J.K., Wind, T & Andreasen, P .A (20 02) The vitronectin binding area of plasminogen activator inhibitor-1, mapped by mutagenesis and protection against an inactivating organochemical ... sulphuric acid (data not shown) In contrast, the monoclonal antibody against PAI-1 Mab-5, having an epitope not overlapping that of Mab-1 [38], did not protect PAI-1 against XR5118 and bis-ANS The ... previously [29 ] Two other monoclonal antibodies against PAI-1, Mab2 [29 ,36,37] and Mab-5 [38], were produced and puriﬁed in the same way Other proteins and miscellaneous materials Bis-ANS was from...

8
547
0

Báo cáo khoa học: Identiﬁcation of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx

Ngày tải lên : 30/03/2014, 11:20

... AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...

10
308
0

Báo cáo hóa học: " Neutralizing human monoclonal antibody against H5N1 influenza HA selected from a Fab-phage display library" pptx

Ngày tải lên : 20/06/2014, 01:20

... with the ability to bind to all of the HA-FO described in table in a confirmatory monoclonal ELISA (Table 2) Figure of Analysis HA-FO and H5-VLP Analysis of HA-FO and H5-VLP (A) The indicated HA ... for an antibody against a conformational epitope formed by HA1 and HA2 which inhibits conformational changes necessary for fusion [ 32] , these antibodies have been found to be non-neutralizing in ... response against HA, be it from natural infection or vaccination However, it also possible that the correlation between neutralization activity against VLP and virus observed for antibodies against...

10
418
0

Báo cáo y học: " Polyclonal antibody against the DPV UL46M protein can be a diagnostic candidate" pot

Ngày tải lên : 12/08/2014, 04:20

... corresponding antibody characteristics revealed significant theoretical and practical value for understanding the molecular mechanism of DPV For the preparation of the anti-UL46 rabbit antibody, factors ... preventing proteolytic degradation of the protein The Dot-ELISA has become a new addition to the diagnostic arsenal against microbes, contagious and parasitic diseases, because it is easy to use, is ... protein had a relative molecular mass of 79 kDa, while expression of the full UL46 gene failed The recombinant protein was used to generate the polyclonal antibody against UL46M in rabbits ELISA and...

10
271
0

Tài liệu Báo cáo " Liệu pháp Gene Dùng Adenovirus gián tiếp tạo ra kháng thể HER-2" pptx

Ngày tải lên : 23/01/2014, 06:20

... commercial trastuzumab was usedas control Immunofluorescent microscopy analysis for the specific binding of antiHER -2 antibody to HER- 2 A to B, BT549 incubatedw ith supernatant and trastuzumab, respectively ... supernatants were harvestedat different time points after infection for protein analysis A, ELISA analysis of supernatants of Ad-TAb -infected L- 02 cells Columns, mean; bars, SD.Western blot analysis ... SKOV-3 incubatedw ith trastuzumab and culture supernatant, respectively Nhóm 10: shptyd Fig Affinity constant of anti -HER- 2 antibody Indirect ELISA was applied for estimation of the antibody binding...

31
449
1

Báo cáo khóa học: Differential carbohydrate epitope recognition of globotriaosyl ceramide by verotoxins and a monoclonal antibody pdf

Ngày tải lên : 16/03/2014, 16:20

... binding, and AP, staining red, was used to detect either VT2 or anti-Gb3 binding Immunolabelling resulted in a purple stain where VT1 and anti-Gb3 colocalized In the majority of samples, the staining ... serial section stained at °C (b) VT1 glomerular staining is seen at °C but is absent at 37 °C Tubular staining is more distinct and discriminatory at 37 °C Magniﬁcation, 22 residual unlabelled ... Comparison of ligand/Gb3 binding by RELISA The binding of VT1, VT2, and mAb anti-Gb3 (38.13) to Gb3 was assessed using a RELISA where binding was determined as a function of the ligand concentration...

13
398
0

Báo cáo hóa học: " Vaccination with a plasmid DNA encoding HER-2/ neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial" pptx

Ngày tải lên : 18/06/2014, 16:20

... including breast, ovarian, cervical and renal carcinoma [1 ,2] and represents an attractive therapeutic target Trastuzumab (Herceptin), a recombinant humanized monoclonal antibody binding Her2 , ... containing a mutation in codon 753 to convert a lysine (AAA) to an alanine (GCA) residue in the ATP binding site [25 ,26 ] was used From the pCMV-E 2A vector the E 2A insert was subcloned into pVax1 ... ( 12. 5%) patients enrolled in the study had a pre-existing antibody response against Her2 , as defined by a binding activity >2 The majority of evaluable patients (3/5) showed an increased Her2 -specific...

11
606
0

The A to Z of the Vikings 2 pot

Ngày tải lên : 02/07/2014, 04:21

... Klak for Frankish support against sons of Godfred 825 Vikings attack Hebridean island of Iona again, killing its prior, Blathmac 826 Harald Klak, his family, and his followers baptized at Mainz, ... Louis the Pious standing as sponsor Missionary priest, Ansgar, accompanied Harald to Denmark 827 Harald Klak of Denmark forced into exile 829 –831 Ansgar visited Birka in Sweden 8 32 Ansgar appointed ... Frankia 800 Coastal defenses against Vikings organized by Charlemagne 8 02 Monastery on Hebridean island of Iona attacked by Vikings 806 Another Viking attack on Iona left 68 monks dead c 808 Danish...

10
370
0

BIỂU HIỆN THỤ THỂ ESTROGEN, PROGESTERON, GEN P53, Ki67, HER-2/NEU TRONG UNG THƯ BIỂU MÔ potx

Ngày tải lên : 01/08/2014, 19:20

... 95 cases of breast ductal carcinoma Materials-Methods: 95 cases of breast ductal carcinoma were operated in Armed Force Medical Institute 103 during 1 /20 01- 12/ 2006 All specimens were studied in ... Her- 2/ neu p53 with low rate Conclusions: Invasive ductal carcinoma is the most common in breast cancer, and the incidence of positive ER, PR is rather high, but The expression of Ki67, Her- 2/ neu ... studied in surgical pathology and immunohistochemistry Results: Invasive ductal carcinoma with the rate 77,89%, ductal carcinoma in situ 10, 52% The expression of ER: 62, 10%, PR: 57,89% The expression...

13
1.8K
16