transmission only one entity can send at a time in a full duplex transmission both entities can send at the same time
How can children be obese and hungry at the same time? pot
Ngày tải lên :
17/03/2014, 17:20
... NBCDI, The Wal-Mart Foundation, and the Donna Joyner Foundation, BCDI-G is partnering with The Hayes Taylor YMCA, a facility that has been serving the African American community for over 50 years, ... will have the opportunity to plant and watch a garden grow as they and their parents work together to bring a message that a meal can be good and still bless your heart I For additional information ... Child Health Talk that will focus on programs making a difference in improving the health of our children and families in communities across America To nominate a program that is achieving great outcomes...
- 16
- 440
- 0
Báo cáo lâm nghiệp: "Macronutrients in tree stems and foliage: a comparative study of six temperate forest species planted at the same sites" pps
Ngày tải lên :
08/08/2014, 01:22
... (1.0) a Cation exchange capacity was determined as the sum of the extractable amounts of H+, Na+, K+, Ca+, Mg2+, Al3+, Fe3+ and Mn2+ from the BaCl2 extraction b Base saturation was calculated as the ... concentrations at the same site can vary from year to year depending primarily on weather conditions However, a long-term comparative study in Denmark [9] showed that the variation in foliar nutrient ... may partly explain why the Ca concentrations in oak and beech were similar in our study, as the bark was included in the analysed samples Concentrations of Ca in the stemwood may depend on water...
- 10
- 443
- 0
How To Enjoy Money And Life At The Same Time by Steve Rhode pot
Ngày tải lên :
27/06/2014, 23:20
... It is also the source of my inner strength From that pain and financial devastation I was able to go on to help others God gave me a doctorate in financial defeat And as strange as it may sound ... team playing that day We arrived late and grabbed the last two seats in the wooden bleachers I always have fond memories of wooden bleachers; the aluminum ones of today are just not as satisfying ... personalities, behavior, the chemicals in our brains and even the neural pathways, which are hardwired in our brains, also regulate it Now I’m not saying that you are a victim, I’m saying that there...
- 93
- 396
- 0
The ULTIMATE Your Guide to Good Health One Cup of Tea at a Time pptx
Ngày tải lên :
22/03/2014, 18:20
... choices There are sweet teas, pungent teas, salty teas, light teas, and heavy teas There are fruity teas and spicy teas There are teas in bags and teas in tins There are teas that are relatively ... Africa The mild flavor of Rooibos, and the fact that it is naturally decaffeinated, has made it a popular component of herbal drinks that are blended with other ingredients, such as chocolate, caramel, ... instance, if it is a Green Pineapple Tea, are there bits of pineapple in it, or have they added pineapple flavoring? Dried fruit means more care went into the mixing and may also indicate that the...
- 320
- 555
- 0
Báo cáo khoa học: Structure of a trypanosomatid mitochondrial cytochrome c with heme attached via only one thioether bond and implications for the substrate recognition requirements of heme lyase potx
Ngày tải lên :
23/03/2014, 04:21
... heme attachment to cytochrome c in yeast, heme lyase, can mature a trypanosomatid cytochrome c Heme lyases can mature AXXCH variants of yeast or human cytochrome c, albeit at a lower level than the ... free-living phagotrophic flagellates (e.g Bodo saltans), photosynthetic algae (e.g Euglena gracilis), and parasitic trypanosomatids [e.g the causal agents of the tropical diseases African sleeping ... through only one cysteine residue to an (A ⁄ F)XXCH heme-binding motif, rather than through two thioether bonds to CXXCH, as in all other eukaryotes No apparatus for the post-translational attachment...
- 11
- 513
- 0
Báo cáo y học: "Characterization of an H3N2 triple reassortant influenza virus with a mutation at the receptor binding domain (D190A) that occurred upon virus transmission from turkeys to pigs" potx
Ngày tải lên :
12/08/2014, 01:22
... amino acids are negatively charged, while Ala is a neutral amino acid We assume that Ala at the corresponding position (Figure 1) might not affect the configuration, but rather the charge at ... Tuzikov A, Bovin N, Gambaryan A, Klimov A, Castrucci MR, Donatelli I, Kawaoka Y: Early alterations of the receptor-binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their ... Senne DA, Suarez DL: Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control...
- 7
- 512
- 0
Báo cáo khoa học: " A morphological and molecular study of Anaplasma phagocytophilum transmission events at the time of Ixodes ricinus tick bite" pps
Ngày tải lên :
12/08/2014, 18:22
... were associated with the leukocytes of the infiltrate at the tick bite site, indicating that PMNs and other inflammatory cells are attracted to the area and may provide a possibility for survival ... collected from animals having PCR negative blood, indicating that the organisms Granquist et al Acta Veterinaria Scandinavica 2010, 52:43 http://www.actavetscand.com/content/52/1/43 Page of Table 1: ... lymphocytes and macrophages (Fig 1b) The perivascular aggregates were mainly composed of mononuclear inflammatory cells A substantial number of lambs, 14 Granquist et al Acta Veterinaria Scandinavica 2010,...
- 7
- 241
- 0
Báo cáo y học: "The electronic version of this article is the complete one and can be found online at" pps
Ngày tải lên :
14/08/2014, 14:21
... DD|395578 DV|206272 GGCCAAACAGGTTAAACCCTTAATTCCGTTTGTGTTGGAGGAATAGGTATGCCGACTTATGTTGATCCGTCCAAGTGTGATG -GCCAAGCA -AACCCTTAATTCTGTTTGAGTTGGAGGATAAGGTATGCCGACTTATGTTGATCCGTCCAAGTGCGACG ***** ** ************ ... cTGAtAAaGAaacTCAc 105 3.87 AaGAAAcTCAcTaTCAg Zn-dependent peptidase, Fe regulator 4.55 -189 tTGAAAtTCtTTaTCgc pep*-fur1 4.56 -116 gTGAtAtTGAaaTTCtT 394231 -122 tTGAcAtTGAaaaTCAT AraC-type regulator ... DD|395578 DV|206272 CTGTTGACAGTGTAAGGTGAGCTTTGTTAAATATCTCACAAGCGCA-CGGGCCAACGAACTCGTAAAAGTCTCCGTTAGGCA CGCTTGACACATCAGGGGTGACATTGTTAATTCCATCACAAGCGCAGCGGGCTCCCCA -CAACGAAGTGTT G * ****** * **...
- 27
- 356
- 0
A study on possible effective pre-reading activities to improve reading skills for 2nd- year english majors at the military science academy
Ngày tải lên :
07/11/2012, 14:50
... such as Water Sports in Hawaii, and Natural Disasters in Hawaii and Hawaiian Traditions, etc, Hawaii nowadays, in fact, rather familiar to many students, however, many of them are still lack information ... using visual aids can focus attention on meaning and help to make the language, using visual aids in the class in general and in the reading lesson in particular can bring students back to real ... the readers to have something to look at is eye-caching and relevant to the task in hand There are many advantages of using visual aids in a reading lesson that the teacher can use First of all,...
- 45
- 1.7K
- 22
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
Ngày tải lên :
17/04/2013, 16:09
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
- 137
- 853
- 0
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
Ngày tải lên :
07/09/2013, 13:02
... why the Ministry of Education and Training needs to innovate the way of the second language teaching by applying the communicative approach in teaching English in Vietnamese classrooms In addition, ... performance) and within/online planning (during task performance) Pre-task planning is further categorized into rehearsal (learners repeat exactly what they planned) and strategic planning (learners ... because they have to live in the military barrack all the time On the other hand, all the 16 students share very common background, studying in the same class, the same department of the same Academy,...
- 77
- 890
- 5
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY
Ngày tải lên :
07/09/2013, 13:45
... that pronunciation practice in class had little affect on the learner's pronunciation skills and, moreover ‘that the attainment of accurate pronunciation in a second language is a matter substantially ... substantially beyond the control of educators’ They qualified their findings by stating that variables of formal training and the quality of the training in pronunciation could affect the results, as ... top-down, intuitive-imitate approach, analytic-linguistic approach, and approach of integrating The techniques mainly used in their teaching pronunciation were ‘listen and imitate’ and ‘reading aloud’...
- 40
- 984
- 4
Shaking a box of sand II – at the jamming limit, when shape matters
Ngày tải lên :
01/11/2013, 08:20
... configurational landscapes and surface intermittency We have in the above focused largely on the fast dynamical behaviour of the top of a column of grains in the jamming limit, alluding to an increasingly ... discussed above This was explored via rattlers (sites i such that the local field h i = 0) in the blocked configurations generated after each tap We have seen above that they have a rather crucial role ... provides a natural reconciliation between, on the one hand, the intuitive perception that not all microscopic configurations can be equally visited during compaction in the jamming limit, that the...
- 11
- 392
- 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university
Ngày tải lên :
27/12/2013, 20:26
... negotiating meaning with the speaker and responding (collaborative orientation); and, creating meaning through involvement, imagination and empathy (transformative orientation) Howatt and Dakin (1974) ... storage, retrieval, and use of information." Weinstein and Mayer (1986) defined language learning strategies as the behaviour and thought’ that a learner engages in during learning that are intended ... acquiring the meaning of the message based on the incoming language data from sounds, to words, to grammatical relationships, and ultimately to the meaning Schemata are hierarchically formed This acknowledges...
- 99
- 805
- 0
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
Ngày tải lên :
29/01/2014, 10:33
... No planning groups & Pre-planning groups) Records: All the group discussions and the individual presentations from No planning group & Pre-planning group Group Data Analysis Language Related ... Suggestions Group planning prior to individual presentations is really useful Group planning should be applied and encouraged in the classroom Further study: - Investigate in three areas: fluency, ... difference in the number of turns among the participants Leadership moves - One or two students seem to be leaders in every talk Individual Presentation Findings most of the participants in PTP...
- 15
- 798
- 0
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
Ngày tải lên :
29/01/2014, 10:49
... They all have had or are going to have, in the near future, M .A Degree in Education or Linguistics 2.1.5 Data collection Instruments The study is both quantitative and qualitative The data is collected ... improving the peer-teaching process Data is reported at the cohort level because responses were similar statistically 2.2 Data Analysis and Interpretation The data is presented in the two tables ... reveals that both the teachers and students have a good grasp of the role of the learners in ESP teaching Based on the theory of learner-based teaching, we know that class activities can be done...
- 40
- 903
- 3