white - forest genetics (cabi, 2007)
... Organization, Gene Structure and Regulation 15 Chapter 3: Transmission Genetics - Chromosomes, Recombination and Linkage 35 Chapter 4: Genetic Markers - Morphological, Biochemical and Molecular Markers ... Gene Expression Summary and Conclusions 15 15 15 17 18 19 21 22 26 26 27 29 30 33 Chapter 3: Transmission Genetics - Chromosomes, Recombination and Linkage 35 Mendelian Genetics Mendel's Crossing ... Species and Interspecific Hybrids Subspecies, Varieties, Provenances and Land Races Choosing Species, Hybrids and Seed Sources for Plantation Forestry Identifying Candidate Species, Hybrids and Seed...
Ngày tải lên: 03/04/2014, 12:12
... Müller-Starck and Ziehe (1991) Genotyping proceed Genetic control and inheritance of isoenzymes verified beforehand by utilizing full-sib families and their parents of Q robur and Q petraea (Müller-Strack ... different stands which all together belong to the same region of provenance (’multipopulation samples’); and 2) material which originates from single oak stands which cover areas of 50-100 All stands ... (Müller-Strack and Hattemer, 1990) For extraction of bud and leaf tissues, enzymes were separated by starch-gel electrophoresis and isoelectric focusing mean of genotyping see MüllerStarck and Ziehe...
Ngày tải lên: 08/08/2014, 19:21
... ; C & L 1985) about the OYNE , LIEB TT O , ANDE , ANDE number and effect of loci that control quantitative variation II A Full sib analysis Theory and variation among isofemale strains Perhaps ... Heritabilities and standard errors for the sib analysis were estimated according to the methods in FALCONER (1981) Intraclass correlations (t) were obtained for the isofemale strain analysis, and standard ... quarter of the additive genetic variance and a quarter of the dominance variance, and the within strain component contains half the additive genetic variance and three quarters of the dominance variance...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: "Allozyme variation in natural populations of Lymantria dispar (Lepidoptera)" docx
... acid and one aspartate aminotransferase The three-banded heterozygotes for Est-1 and Est-5 loci indicate that enzymes are at least dimers, the other enzymes being probably monomeric with two-banded ... French and Japanese populations of Drosophila melanogaster For the populations of France and Morocco, while the geographical distance is lower than between France and China, the Nei’s standard ... Among the ten loci, two are monomorphic (Est-2 and Aat), five are diallelic (Est-1, Est-5, Acph-4, Lap-2 and Lap-4), three alleles occur at Acph-6 and Lap-3 loci, Est-4 has four alleles including...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo lâm nghiệp: "Variation of morphological traits in natural populations of maritime pine (Pinus pinaster Ait.) in Morocco" pot
... molecular markers and quantitative traits [24] In Morocco, maritime pine grows in natural stands on a variety of soil types and climatic conditions, both in mountain and low lands environments ... Measured traits are cone length and width, seed length, width, depth and weight, wing length and width, needles length width and number of stomata rows on the convex and dorsal face of the needle ... contrast, seeds and cones were largest in the high Rif and smaller in the low lands Precipitation in the high-altitude Rif is two-fold the precipitation in the lowlands In fact, populations PC and KR...
Ngày tải lên: 08/08/2014, 00:22
báo cáo khoa học: " Variation at four enzyme loci in natural populations Drosophila melanogaster : factor analyses of genotypic and gametic associations Angeles ALONSO-MORAGA" pdf
... case the individuals are the populations, and the variables are the genotypic and gametic frequencies II Material and methods Two wine cellar populations and two field populations of Drosophila ... M A., 1986 Allozyme ERRANO -S OZ V U1 brium of Adh and a-Gpdh loci in wine cellar and field ter Experientia, 42, 1048-1050 polymorphism and linkage disequilipopulations of Drosophila melanogas- ... chromosome, 38.8 cM) and aldehyde oxidase (Aldox locus, 3rd chromosome, 56.6 cM) The procedures for electrophoresis and staining are described by O’B & MCIN!RE (1969), I!ICKINSON (1970) and P (1957)...
Ngày tải lên: 09/08/2014, 22:22
Báo cáo sinh học: " Phenotypic and genetic variability of morphometrical traits in natural populations of Drosophila melanogaster and D simulans. I. Geographic variations" docx
... Seychelles and the Mascarene Islands; Southern Africa; North America (northern USA and Canada); West Indies; southern USA and Mexico; the Society Islands and Hawaii; the Far East; and Australia ... France and ex-USSR; populations of tropical regions including the West Indies, the Society Islands and Hawaii ; and populations in tropical Africa, the Seychelles and the Mascarene islands Between ... Southern USA and Mexico; and the Seychelles and the Mascarene Islands Latitudinal variations of the morphometrical traits were mainly analysed along a transect between tropical Africa and Europe...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: " Phenotypic and genetic variability of morphometrical traits in natural populations of Drosophila melanogaster and D simulans. II. Within-population variability" pptx
... according to Parsons (1983) and Hoffmann and Parsons (1988) Means and standard deviations of intraclass correlations are given in table IV In both species, the observed and theoretical distributions ... America, West Indies and Mexico, Far East and Australia Geographical groups for D simulans: France, North Africa, Tropical Africa, South Africa, French West Indies, Mexico and USA, Islands of Indian ... weight and wing length with values ranging between 0.40 and 0.53 We then find the bristle numbers (range 0.21 and 0.32) Although thorax length is related to size, it is less variable (0.18 and 0.23...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo sinh học: "Estimation of relatedness in natural populations using highly polymorphic genetic" docx
... of bands of individuals a and b, and n the number ab b of bands shared by a and b This expression, which corresponds to the proportion of bands shared between individuals, varies from (if a and ... by Rouault and Capy (1986) and by Capy and Rouault (1987) will be proposed MATERIALS AND METHODS Basic model and identity between individuals Each individual is defined by a set of bands obtained ... shared bands; these bands being identical by state or by descent (Lynch, 1988) The expression proposed by Nei and Li (1979) will be used In this, the identity between a and b is: where na and n...
Ngày tải lên: 14/08/2014, 20:20
ANALYSIS OF GENETIC VARIATION IN ANIMALS pdf
... Hideyuki Imai and Misuzu Aoki Chapter Genetic Variation of Host Immune Response Genes and Their Effect on Hepatitis C Infection and Treatment Outcome 167 Pooja Deshpande, Michaela Lucas and Silvana ... Nature Genetics 6: 136-145 Kantanen, J.; J Vilkki, K Elo, and A Maki-Tanila 1995 Random amplified polymorphic DNA in cattle and sheep: application for detecting genetic variation Animal Genetics ... Animal Genetics 30: 431-438 MacHugh, D E.; M D Shriver, R T Loftus, P Cunningham, and D G Bradley 1997 Microsatellite DNA variation and the evolution, domestication and phylogeography of taurine and...
Ngày tải lên: 28/06/2014, 08:20
Báo cáo lâm nghiệp: "Enzymatic polymorphism in natural populations of the sawfly Diprion pini L (Hymenoptera: Diprionidae) L Beaudoin" ppsx
... a solution of α-naphtylacetate (0.2%) and β- female esterase E was monomorphic and proceeded from the female cementary gland (Beaudoin and Allais, 1991) The patterns obtained from ... sylvestris between June and September 1988 from three plain sites, Romorantin, Loiret (115 m asl, n 18), Lorris, Loiret (130 m, n 25) and Rambouillet, Yvelines (150 m, n = 22) and in three mountain ... ie, heterozygoty (H) and enzymatic polymorphism (P) Nei distances (Nei, 1972), within and between populations, were calculated The results were expressed in matrical form and a dendrogram was...
Ngày tải lên: 08/08/2014, 18:21
Báo cáo khoa học: "Gene diversity in natural populations of oak species" doc
... rubra, Q coccinea, Q ilicifolia and Q velutina (Manos and Fairbrothers, 1987); and complex 2, comprised of Q rubra, Q marilandica, Q phellos and Q velutina (Guttman and Weight, 1989) Q alba complex ... Hybridization and mating system in a mixed stand of sessile and pedunculate oak Ann Sci For 50 (suppl 1), 122s-127s Birky CW (1991) Evolution and population genetics of organelle genomes: mechanisms and ... species and originate from 13 references These species belong mainly to sections Lepidobalanus (white oaks) and Erythrobalanus (red oaks) and are distributed over North America, Europe and Asia...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: " Estimation of Fagus sylvatica L mating system parameters in natural populations" pps
... Ritland and Jain (1981) and Ritland and El Kassaby (1985) The assumptions used were those of the mixed mating model (Fyfe and Bailey, 1951): (i) each mating event is a result of either a random ... anemophilous, and self-fer- trees: Eucalyptus (Brown et al, 1975; Phillips and Brown, 1977; Moran and Brown, 1980), tropical trees (O’Malley and Bawa, 1987; tile but mainly outcrossing species (Nielsen and ... population estimates (t ) m In the Issaux stands, tree multilocus estimates were close to and no intra-stand individual heterogeneity was found using Ritland and El Kassaby’s method (1985) (table II)...
Ngày tải lên: 08/08/2014, 19:21
Báo cáo khoa học: "Genetic variation in European larch (Larix decidua Mill)" potx
... laricina (Cheliak and Pitel, 1985; Ying and Morgenstern, 1990) and at IDH for L laricina (Cheliak and Pitel, 1985) as well as for L occidentalis (Fins and Seeb, 1986) Lewandowski and Mejnartowicz ... results from other isozyme investigations in larch (Cheliak and Pitel, 1985; Fins and Seeb, 1986; Lewandowski and Mejnartowicz, 1990a, b; Ying and Morgenstern, 1990) were the basis for genetic interpretation ... inferred as four loci and an interlocus heterodimer, was recorded for MDH On account of poor band resolution, MDH-B and MDH-C were not further analysed Both MDH-A and MDH-D performed bands suggesting...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo khoa hoc:" Genetic variation in two conserved local Romanian pig breeds using type 1 DNA markers" pdf
... of Hungary and also in Transylvania and was produced from crosses between Roman and wild pigs [1,10] Pigs from this breed were well regarded and were prize winners in the Paris (1855) and Vienna ... reported by Sun et al [36] and it was found to be fixed in some Chinese breeds and the most common in improved breeds such as Large White and Landrace as well as Berkshire and Hampshire Allele A had ... and Bazna populations from Romania Ten genes were chosen for the study, three of which (CRC1, FUT1 and MC1R) have polymorphisms known to change gene function and phenotype, three (ESR, PRLR and...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: "Genetic variability in French populations of the Corsican mouflon (Ovis ammon musimon): analysis of 2 blood proteins and red-cell blood groups" pptx
... Be, Bf, Bg, Bh, Bi, BF3, BF35, BF38 and BF418 for OEA-B; Ca, Cb and CF5 for OEA-C; Da for OEA-D; Ma and Mb for OEA-M; R and for OEA-R; F30 and F275 Hemolytic and hemagglutination techniques were ... Jouy-en-Josas and Lunaret) and feral ones (Corsica, Bauges, Caroux and Blood Italy) (table I) Genetic systems of transferrin and hemoglobin was detected by starch-gel electrophoresis (Nguyen and Bunch, ... result of mainland introductions from native populations on Corsican and Sardinian islands (Tomiczek, 1985; Uloth and Prien, 1985) Numerous European countries (from Spain to ex-USSR) and other parts...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo sinh học: "On the relevance of three genetic models for the description of genetic variance in small populations undergoing selection" docx
... algorithm, initiated by Hospital [8] and developed by Fournet et al [7], uses the Monte-Carlo principle and provides the mean values and standard deviations for genetic mean and variance over time a 2.2 ... between the absence of linkage and a recombination rate of 0.1, but below r 0.01, stronger linkage led to a higher decrease in genetic variance in the early generations and a lower asymptotic ... ones and are poorly eliminated because of the low recombination rate in the second phase When linkage is less intense, the gametes are reorganized by recombination over a longer period and the...
Ngày tải lên: 09/08/2014, 18:22
Population genetic variation in gene expression is associated with phenotypic variation in Saccharomyces cerevisiae pdf
... aggregation and fragmentation of proteins and DNA damage [22] Thioredoxin peroxidase (TSA1) and thioredoxin (TRX2) function in redox homeostasis and are regulated by the transcription factors Yap1p and ... SUP35, 5'AAAATCCCAACCCTACGGTA and 5'CCACTGTAGCCGGATACTGGCA, respectively For each strain both DNA strands were sequenced and analyzed using Phred, Phrap and Consed [62] and polymorphic sites were ... copper sulfate (Figure 1), but so are M5, M32 and S288C CUP1 was expressed at the lowest levels in M13, S288C, YPS163 and M34, and while M13, YPS163 and M34 are the most copper-sensitive strains...
Ngày tải lên: 09/08/2014, 20:20
báo cáo khoa học: "Population crash, population flush and genetic variability in cage populations of Drosophila melanogaster" pot
... Oregon strain were placed in population cages at 21°, 25° and 29 °C, respectively The 2 1and 25 °C populations expanded rapidly in number and attained, after a few weeks, a stable population size ... cages (Oregon populations) and in the three culture bottles (Bonlez populations), the thorax size of samples of 50 females and 50 males was measured and the mean size and the variance of the size ... females and 48 males were measured for sternopleural bristle number, at each generation, both in a high and a low line 12 lines were thus created The 12 females and the 12 males with the highest and...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo khoa hoc:" Genetic variation in the myeloperoxidase gene and cognitive impairment in Multiple Sclerosis" pot
... collection and analysed the results FC performed the statistical analysis RN, ML, AC, VA, DP and RC partecipated to acquisition of data AQ conceived the study and partecipated in its design and coordination ... Nelissen I, Fiten P, Vandenbroeck K, Hillert J, Olsson T, Marrosu MG, Opdenakker G: PECAM1, MPO and PRKAR1A at chromosome 17q21-q24 and susceptibility for multiple sclerosis in Sweden and Sardinia Neuroimmunol ... patients a power of 80% and a significance level of 0.05, the power calculation for the A allele shows that the ORs detectable as significant resulted lower than 0.618 and higher than 1.527 These...
Ngày tải lên: 11/08/2014, 08:20