towards a modular and multi dimensional perspective

Cambridge studies in linguistics  Phoevos panagiotidis categorial features  a generative theory of word class categories cambridge university press (2015)

Cambridge studies in linguistics Phoevos panagiotidis categorial features a generative theory of word class categories cambridge university press (2015)

... and JAIRO NUNES: Control as Movement MICHAEL ISRAEL: The Grammar of Polarity: Pragmatics, Sensitivity, and the Logic of Scales M RITA MANZINI and LEONARDO M SAVOIA: Grammatical Categories: Variation ... Categories: Variation in Romance Languages BARBARA CITKO: Symmetry in Syntax: Merge, Move and Labels RACHEL WALKER: Vowel Patterns in Language MARY DALRYMPLE and IRINA NIKOLAEVA: Objects and Information ... know what the attributes [N] and [V] stand for All we have at this point is nouns and adjectives forming a natural class, both being [ỵN], and verbs and adjectives forming a natural class because...

Ngày tải lên: 27/10/2016, 08:40

226 767 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... the manufacturer’s procedures, and used as templates for PCR, with 70b F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) ... mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b (Fig 1A) The T-DNA insertion in AtRPA7 0a (atrpa7 0a) was lethal, ... AACCGAGATGGTCGGCAAC) and AtRPA7 0a- 3¢ (AA CAGTCATCTTCACTCTTTGT); AtRPA70b-5¢ (TTCAA CTTTGTACCCATTGAT) and AtRPA70b-3¢ (TTCACCG CCATTATATACCTTA) These primers were used to obtain a fragment of 722...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot

Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot

... Neither approach is satisfactory Though conceptually more attractive, the integrated approach makes the grammar unwieldy (it is spread throughout the plan library) and is slow and impractical m after ... realization component requires further guidance This approach interleaves planning and realization and is characterized by a two-way communication at the realizer's decision points The advantages ... are: First, it allows the separation of planning and realization tasks, enabling them to be handled in appropriate terms (In fact, it even allows the separation of special-purpose planning tasks...

Ngày tải lên: 08/03/2014, 18:20

8 434 0
Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx

... In fact, the catalytic proton enhances the rate dramatically both in the separated a and b chains, by a factor of more than 106 per mole for state A and state B as well In this proton catalysis, ... separated a and b chains in 0.1 M buer at 35 C Taken from Tsuruga et al [8] 4046 K Shikama and A Matsuoka (Eur J Biochem 270) ể FEBS 2003 Table Rate constants and acid dissociation constants ... experimental data with the aid of a computer As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely in terms of an ễacid-catalysed...

Ngày tải lên: 17/03/2014, 10:20

11 371 0
Báo cáo hóa học: "Research Article Schur-Convexity of Two Types of One-Parameter Mean Values in n Variables" ppt

Báo cáo hóa học: "Research Article Schur-Convexity of Two Types of One-Parameter Mean Values in n Variables" ppt

... [12] A W Marshall and I Olkin, Inequalities: Theory of Majorization and Its Applications, vol 143 of Mathematics in Science and Engineering, Academic Press, New York, NY, USA, 1979 [13] J.-C Kuang, ... (German) ¨ [3] H Alzer, “Uber eine einparametrige Familie von Mittelwerten II [On a one-parameter family of mean values II],” Bayerische Akademie der Wissenschaften Mathematisch-Naturwissenschaftliche ... Wisenc schaften, Springer, New York, NY, USA, 1970 10 Journal of Inequalities and Applications [15] A W Roberts and D E Varberg, Convex Functions Pure and Applied Mathematics, vol 57, Academic...

Ngày tải lên: 22/06/2014, 06:20

10 311 0
Báo cáo lâm nghiệp: "Comparison of two types of ECOLURE lure on Ips typographus (L.) (Coleoptera: Scolytidae)" doc

Báo cáo lâm nghiệp: "Comparison of two types of ECOLURE lure on Ips typographus (L.) (Coleoptera: Scolytidae)" doc

... beetles was always counted by means of a calibrated glass cylinder because it is assumed that ml of eight-toothed spruce bark beetles is equal to 35 individuals Data analysis STATISTICA 8.0 software ... (dependent samples) in the case of normal data distribution and by Wilcoxon matched pairs test in the case of other data distribution Differences in ten-day checkings and also in the total seasonal number ... CLASSIC gradually decreases and that is why the value of the C/T index also decreases until the bag of ECOLURE CLASSIC is partly opened again As the efficiency of ECOLURE TUBUS gradually decreases,...

Ngày tải lên: 07/08/2014, 10:22

5 339 0
Báo cáo khoa học: "Five-year field performance of two types of Douglas fir mini-plug transplants in three forest sites in France" pot

Báo cáo khoa học: "Five-year field performance of two types of Douglas fir mini-plug transplants in three forest sites in France" pot

... diameter and growth were analysed using analysis of variance (ANOVA) Its use supposes the lay-out to be orthogonal (all treatments have living and healthy plants in all blocks) and each variable ... survival appeared as early as the planting year, and may have been associated with transplanting shock With the + stock, a significant difference appeared between the third and the fifth year after ... survival, height and diameter at1 m above ground line At Varanguebec, an additional final measurement was made on wind-stability because of wind-throw damage in January 1995 due to exceptional monthly...

Ngày tải lên: 08/08/2014, 14:21

13 219 0
Resources and capabilities for two types of servitization contingency on offering nature and serving mode

Resources and capabilities for two types of servitization contingency on offering nature and serving mode

... 2004, Oliar and Sprigman 2008) Barney (2001) and Makadok (2001) claimed that companies that build their strategies on path development, causally ambiguous, socially complex, and intangible assets ... et al 1996, Song and Parry 1997, Song and Parry 1997, Cooper 1998, Khurana and Rosenthal 1998, Avlonitis, Papastathopoulou et al 2001, Blindenbach-Driessen and van den Ende 2006, de Brentani ... success antecedents (Cooper and de Brentani 1991, AtuaheneGima 1996, Brouwer 1997, Sirilli and Evangelista 1998, Nijssen, Hillebrand et al 2006, Amara, Landry et al 2008) Table by de Jong et al (2003)...

Ngày tải lên: 02/10/2015, 17:14

176 935 0
Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

... - Grammatical metaphor can be classified into logical, experiential, interpersonal and textual metaphor - Nominalization and verbalization are essential in creating grammatical metaphor An investigation ... are grammaticalized as interrogatives and commands as imperatives Textual meanings are concerned with the interaction of interpersonal and ideational information as text in context Lexico-Grammatically ... involved in data analysis are both qualitative and quantitative The concepts of metaphor and emotion was discussed in systemic functional and cognitive approach respectively, and in comparison with...

Ngày tải lên: 07/11/2012, 14:44

53 1K 3
Báo cáo khoa học: Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus ppt

Báo cáo khoa học: Two different types of hepcidins from the Japanese flounder Paralichthys olivaceus ppt

... Hep-JF2-F2 b-Actin 5¢-tgcctgacgggactctccatcc-3¢ 5¢-tgacaagagtcaccagcaga-3¢ RT-PCR 5¢-cctccagctcttgtacctca-3¢ 5¢-tcaaagatgaagacattcagtgc-3¢ Real-time PCR Hep-JF2-R2 5¢-agagctctgctggatgcaaa-3¢ Jfactin-F ... coli, and Grampositive Staphylococcus aureus, Latococcus garvieae, and Streptococcus iniae (Fig 7) Hep-JF2pep has antimicrobial activity against Gram-negative Pasteurella damselae ssp piscicida although ... active against a broad spectrum of Gram-positive and Gram-negative bacteria (Fig 7) Synthetic bass hepcidin was found to have antibacterial activity against only Gram-negative bacteria [12] In...

Ngày tải lên: 30/03/2014, 20:20

8 310 0
Báo cáo khoa học: "Two different types of malignant fibrous histiocytomas from pet dogs" docx

Báo cáo khoa học: "Two different types of malignant fibrous histiocytomas from pet dogs" docx

... in giant cell type MFH Multinucleated giant cells engulfed calcifying material at the site of calcification Areas of necrosis and hemorrhage were seen in the adjacent fat and muscle tissue The ... fibroblasts (H) A, F and G: H&E stain, B, C, D and E: ABC method counterstained with hematoxylin, H: Azan stain A- E: ×66, F and G: ×132, H: ×33 Two different types of malignant fibrous histiocytomas ... was diagnosed as an inflammatory cell type of MFH because of mixed cellularity with a heavy infiltration of lymphocytes, plasma cells, and neutrophils (Fig 1F) An ossifying matrix was also detected...

Ngày tải lên: 07/08/2014, 23:22

3 322 0
báo cáo khoa học: " Two novel types of hexokinases in the moss Physcomitrella patens" ppsx

báo cáo khoa học: " Two novel types of hexokinases in the moss Physcomitrella patens" ppsx

... Kamiya A, Carninci P, Hayashizaki Y, Shinozaki K, Kohara Y, Hasebe M: Comparative genomics of Physcomitrella patens gemetophytic transcriptome and Arabidopsis thaliana: Implication for land plant ... analysis AN, TO, MU and MT cloned the Physcomitrella hexokinases and constructed various plasmids AN, TO, MU and MT transformed Physcomitrella protoplasts and analyzed the GFP expression AN and ... catalytic aspartic acid, which is an asparagine in AtHkl3, and two of the hexose binding residues The less divergent AtHkl1 and AtHkl2 proteins, also thought to be catalytically inactive, have...

Ngày tải lên: 11/08/2014, 11:21

15 325 0
báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf

báo cáo khoa học: " ''''Who''''s who'''' in two different flower types of Calluna vulgaris (Ericaceae): morphological and molecular analyses of flower organ identity" pdf

... http://www.biomedcentral.com/1471-2229/9/148 Figure Comparative SEM observations of abaxial and adaxial epidermal surface structures of C vulgaris perianth organs Comparative SEM observations of abaxial and adaxial ... of abaxial and adaxial epidermal surface structures of C vulgaris tissues Comparative SEM observations of abaxial and adaxial epidermal surface structures of C vulgaris tissues wildtype leaf ... rRNA [GenBank:AF419797] Forward: GGGATGAGCGGATGTTACTT Reverse: CCCTTCCGTCAATTCCTTTA 116 CvAP3 [GenBank:GQ202026] Forward: TCGACGAGCTGAATAGTCTTGA Reverse: TCGACTAGCCCATAGTGTGGAT 190 CvSEP1 [GenBank:GQ202027]...

Ngày tải lên: 12/08/2014, 03:21

15 233 0
Bơm ECD-V - P - Types of Systems in ECD-V Series

Bơm ECD-V - P - Types of Systems in ECD-V Series

... manifold, and enters the cylinders The venturi consists of a "main valve" and a "sub valve" The main valve opens and closes in unison with the accelerator pedal to draw the amount of air that is ... computers, and actuators 2-1 Outline of Intake Air System After being filtered through the air cleaner, the intake air travels through the turbocharger and the venturi, passes through the intake manifold, ... With respect to the major changes that have been made from the ECD-V3, an inner cam mechanism, a highly responsive solenoid spill valve and EDU, and a correction ROM have been adopted 1-4 Injection...

Ngày tải lên: 23/10/2012, 09:09

4 564 2
The Two Lovers of Heaven

The Two Lovers of Heaven

... wilt take From that divinest soft Italian land Fixed shadows of the Beautiful and Grand In sunless pictures that the sun doth make-Reflections that may pleasant memories wake Of all that Raffael ... such a dramatic work may have been suggested to Dr Newman by the Autos Sacramentales of Spain, and especially by those of the illustrious Calderon; but, so far as I can learn, he has derived hardly ... business a little better, we may examine them impartially together Nay, even as it is, Calderon stands so indisputably at the head of all Catholic religious dramatists, among whom Dr Newman has recently...

Ngày tải lên: 06/11/2012, 15:30

11 421 0
An investigation into some types of verbal responses to questions in English and Vietnamese conversation

An investigation into some types of verbal responses to questions in English and Vietnamese conversation

... such a way they form a pair type They call them an adjacency pair The adjacency pair always consists of a first part and a second part The utterance of a first part immediately creates an expectation ... hand in marriage: Pet: And you, good Sir! Pray, have you got a daughter Calld Katherina, fair and virtuous? Bap: I have a daughter, sir, calls Katherina (61: 69) By confirming that he has a daughter ... conversation analysis and discourse analysis 5 1.2.1 Conversation analysis Many conversational analysis researchers have defined ordinary conversation as the kind of casual, social talk that routinely...

Ngày tải lên: 07/11/2012, 14:54

42 1,1K 4
Types Of Interviews

Types Of Interviews

... in a professional environment and applicants should conduct themselves accordingly Casually asking about the interviewer’s hockey puck on his desk is okay but describing the wacky events at the ... Conversational interview These are most closely related to the traditional style of interviewing They appear to be in a more comfortable, relaxed setting but not be fooled, these meetings are still ... the interviewer’s hockey puck on his desk is okay but describing the wacky events at the last game you attended, is not ...

Ngày tải lên: 17/10/2013, 01:15

2 402 0
w