towards a cell therapy for muscular dystrophy technical and ethical issues

Screen of nuclear receptors for the enhanced and alternative generation of induced pluripotent stem cells

Screen of nuclear receptors for the enhanced and alternative generation of induced pluripotent stem cells

... methylated Nonetheless, Kazutoshi Takahashi and Shinya Yamanaka decided to narrow down on a smaller pool of factors amongst the 24 candidate factors that were critical in the formation of the ESC-like ... Kazutoshi Takahashi and Shinya Yamanaka screened a list of 24 transcription factors (Table 1) in search for factors that could reprogram mouse fibroblasts to a pluripotent state48 These factors were ... modulate cell fate and hence bring about various differentiated cells within our body with each cell harbouring the same genetic material but are remarkably still able to assume distinct cellular...

Ngày tải lên: 09/09/2015, 18:56

138 342 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

... distinct human iPSC lines and compared with those of hESCs and somatic cells [90] That study demonstrated that although the hESC and iPSC DNA methylation landscapes are remarkably similar overall, hundreds ... GB, Page 13 of 13 Fink AA, Weder AB, Cooper RS, Galan P, Chakravarti A, Schlessinger D, Cao A, Lakatta E, Abecasis GR: Genome-wide association scan shows genetic variants in the FTO gene are associated ... differentiation protocols These advancements will in turn allow for generation of replacement cells for cellular transplantation approaches and for development of the appropriate ‘disease in a dish’...

Ngày tải lên: 11/08/2014, 12:21

13 338 0
Báo cáo y học: " Induced pluripotent stem cells free of exogenous reprogramming factors" pot

Báo cáo y học: " Induced pluripotent stem cells free of exogenous reprogramming factors" pot

... sickle cell anemia mouse model with iPS cells generated from autologous skin Science 2007, 318:1920-1923 Nakagawa M, Koyanagi M, Tanabe K, Takahashi K, Ichisaka T, Aoi T, Okita K, Mochiduki Y, Takizawa ... pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors Cell 2006, 126:663-676 Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S: Induction ... [Epub ahead of print] Aasen T, Raya A, Barrero MJ, Garreta E, Consiglio A, Gonzalez F, Vassena R, Bilic J, Pekarik V, Tiscornia G, Edel M, Boué S, Belmonte JC: Efficient and rapid generation...

Ngày tải lên: 14/08/2014, 21:20

3 112 0
Generation of porcine induced pluripotent stem cells and their differentiation into cardiac lineages

Generation of porcine induced pluripotent stem cells and their differentiation into cardiac lineages

... Immunocytochemical Staining Gene Secondary Antibody Oct4 Alexafluor® A2 1425 SOX2 Alexafluor® A2 1430 Nanog Alexafluor® A2 1432 SSEA1 Alexafluor® A2 1426 SSEA4 Alexafluor® A2 1425 Tra-1-60 Alexafluor® A2 1426 Tra-1-81 ... utilized as a cellular source to replace damaged tissues In addition, human Embryonic Stem Cells can be used as a platform for drug discovery and toxicology as they can be used as biotools for the ... (Pasumarthi & Field, 2002) for cell growth and renewal Consistently, Carbon dating has shown that cardiomyocytes in the adult human heart has a renewal ability of less than 1% each year (Bergmann...

Ngày tải lên: 30/09/2015, 10:13

108 405 0
Atlas of Human Pluripotent Stem Cells doc

Atlas of Human Pluripotent Stem Cells doc

... in appropriate conditions, and of sustaining a normal karyotype, hESCs may have broad applications for industrial uses; clinical purposes, namely, cell- based therapy; and research of early human ... Technion’s Stem Cell Center by the Sohnis and Forman Families We thank Ilana Laevsky and Atara Novak for their valuable contributions The cooperation and enthusiasm shown by the staff members at Springer ... Human Pluripotent Stem Cells Derivation and Culturing With contributions by Ilana Laevsky, BA and Atara Novak, MSc Michal Amit, PhD Department of Obstetrics and Gynecology Rambam Health Care Campus...

Ngày tải lên: 22/03/2014, 09:20

157 580 0
Báo cáo toán học: "Adult neurogenesis, neuroinflammation and therapeutic potential of adult neural stem cells" ppsx

Báo cáo toán học: "Adult neurogenesis, neuroinflammation and therapeutic potential of adult neural stem cells" ppsx

... patients to neurodegenerative diseases, later in life [29] Figure Adult neurogenesis and neuroinflammation Neuroinflammation has been proposed as a causative factor for neurological diseases and ... dentate granule cells Immunohistochemistry and confocal microscopy analysis of autopsies for markers of the cell cycle and neuronal differentiation, like proliferating cell nuclear antigen and β-tubulin, ... toxic and mutagenic substances Int J Med Sci 2008, It triggers cell death, the formation of teratomes, alters DNA stability, lengthens the cell cycle, and has mitogenic, transcriptional and translational...

Ngày tải lên: 08/08/2014, 17:20

6 232 0
báo cáo khoa học: " Capturing Alzheimer’s disease genomes with induced pluripotent stem cells: prospects and challenges" pps

báo cáo khoa học: " Capturing Alzheimer’s disease genomes with induced pluripotent stem cells: prospects and challenges" pps

... http://genomemedicine.com/content/3/7/49 Page of 11 AD patients and controls Reprogramming iPSCs Quantitative differentiation Drug testing and genetic manipulation Sporadic AD patients Cell therapy? Healthy controls Familial AD patients ... in a mouse model of AD Normally, aged mice that are transgenic for mutant APP, mutant presenilin and mutant tau show impaired performance in cognitive tasks such as the Morris water maze and ... Comparative analysis GWAS validation Animal model validation Identification of novel differences Figure A general approach for the use of iPSCs to model AD Samples from sporadic AD patients, familial...

Ngày tải lên: 11/08/2014, 12:21

11 257 0
Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

Báo cáo y học: "Hypertrophy is induced during the in vitro chondrogenic differentiation of human mesenchymal stem cells by bone morphogenetic protein-2 and bone morphogenetic protein-4 gene transfer" pps

... CCCTTTTTGCTGCTAGTATCC Antisense: CTGTTGTCCAGGTTTTCCTGGCAC 54 468 25 OP Sense: ACGCCGACCAAGGAAAACTC Antisense: GTCCATAAACCACACTATCACCTCG 51 483 35 ALP (rt) Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC ... ATCTCGTTGTCTGAGTACCAGTCC 51 454 IHH Sense: GAGGAGTCCCTGCATTATGA Antisense: CAGGAAAATGAGCACATCGC 54 321 30 RUNX2 Sense: ACAGATGATGACACTGCCACC Antisense: CATAGTAGAGATATGGAGTGCTGC 55 324 35 54 234 25 Internal ... markers COL II Sense: TTTCCCAGGTCAAGATGGTC Antisense: CTTCAGCACCTGTC CACCA 58 374 35 AGC Sense: TGAGGAGGGCTGGAACAAGTACC Antisense: GGAGGTGGTAATTGCAGGGAACA 54 392 30 COMP Sense: CAGGACGACTTTGATGCAGA...

Ngày tải lên: 09/08/2014, 14:22

15 830 0
báo cáo khoa học: " Transcriptomic analysis of pluripotent stem cells: insights into health and disease" potx

báo cáo khoa học: " Transcriptomic analysis of pluripotent stem cells: insights into health and disease" potx

... profile Cellular reprogramming and iPSCs The importance of the transcriptional regulatory network in establishing ESC self-renewal and pluripotency was elegantly demonstrated by Takahashi and Yamanaka ... of the choanae, Retardation of growth and/ or development, Genital and/ or urinary abnormalities, and Ear abnormalities and deafness; ChIP, chromatin immunoprecipitation; ChIP-chip, chromatin immunoprecipitation ... Thomson JA: Induced pluripotent stem cell lines derived from human somatic cells Science 2007, 318:1917-1920 Maekawa M, Yamaguchi K, Nakamura T, Shibukawa R, Kodanaka I, Ichisaka T, Kawamura Y, Mochizuki...

Ngày tải lên: 11/08/2014, 12:21

12 368 0
Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

Báo cáo y học: "Discrepancy between the in vitro and in vivo effects of murine mesenchymal stem cells on T-cell proliferation and collagen-induced arthritis" doc

... manuscript preparation TM and HK contributed to MSC stimulation, quantitative PCR, and Bio-Plex; CIA induction and evaluation; humoral and cellular responses; and analysis of T -cell proliferation LG ... treatment of several autoimmune diseases, prudence is called for in extrapolating in vitro and animal data to the human situation Abbreviations AC: accessory cell; BSA: bovine serum albumin; CFA: ... characterization of MSCs; MSC stimulation, quantitative PCR, and Bio-Plex; CIA induction and evaluation; humoral and cellular responses; analysis of T -cell proliferation; design of the study; and manuscript...

Ngày tải lên: 12/08/2014, 11:23

11 464 0
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

... plates were sealed at the sides with parafilm (for minimal evaporation), and placed in either a 4oC refrigerator, or back into the incubator reset at 25oC An atmosphere of 5% CO2 was maintained ... with the initial absorbance reading for the unexposed physiological control maintained at 37oC Raw absorbance values obtained for % survival MTT assay (after correction for blank, rate n = 6) Unexposed ... B that was partially differentiated, with some areas of nonuniform cell morphology and non-distinct boundaries but with still relatively strong expression of SSEA-3 and TRA-1-81; and 3) Grade...

Ngày tải lên: 31/10/2012, 16:57

6 477 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

... 5¢GGTACCTATATAGGT GACTTACATA-3¢ and DS: 5¢CACCTAAGACACTGTG GAAGAGCAG-3¢; mouseHS2 US: 5¢GGGTCTCTCTA GGAGGAAGTCCACAGG-3¢ and DS: 5¢CAGATCTAAT GACCCTAACTCTAAC-3¢; mouse bmajor US: 5¢GGT GCACCTGACTGATGCTGAGAAG-3 and ... TTTCCCTGATGAGGATTCAATGG-3¢ and DS 5¢-CCC ACACATGGTCATCTATCTGAGC-3¢; mouse HS2 core: US 5¢-TTCCTACACATTAACGAGCCTCTGC-3¢ and DS 5¢AACATCTGGCCACACACCCTAAGC-3¢; ⁄ 2flank, US 5¢-CTATTTGCTAACAGTCTGACAATAGAGTAG-3¢ ... bmajor-globin: US 5¢-AAGCCTGATTCCGTAG AGCCACAC-3¢ and DS 5¢-CCCACAGGCAAGAGACA GCAGC-3¢; mouse ec-globin: US 5¢-CAAAGAGAGTTT TTGTTGAAGGAGGAG-3¢ and DS 5¢-AAAGTTCACCA TGATGGCAAGTCTGG-3¢; mouse HS3...

Ngày tải lên: 07/03/2014, 12:20

10 422 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

... CanonicalCorrelation Analysis Journal of Statistical Software 2008, 23(12):1-14 Takakura S, Mitsutake N, Nakashima M, Namba H, Saenko VA, Rogounovitch TI, Nakazawa Y, Hayashi T, Ohtsuru A, Yamashita ... experiments for the paper, collected and analyzed the data and wrote the manuscript PJ carried out data analyses and assisted with writing the manuscript EW designed the miRNA-array and oligo platform, ... Total RNA was extracted using Trizol reagent and the RNA quality was tested with the Agilent Bioanalyzer 2000 (Agilent Technologies, Santa Clara, CA) The RNA was amplified into antisense RNA (aRNA)...

Ngày tải lên: 18/06/2014, 15:20

17 593 0
Báo cáo sinh học: " Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/b-thalassemia" pot

Báo cáo sinh học: " Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/b-thalassemia" pot

... Jaresitthikunchai and Narumon Phaonakrop, BIOTEC, NSTDA for MS data interpretation and Decyder program tutorial Dr Samart Pakakasama, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital Department ... isoforms sigma, gamma and zeta/delta in HbE/ b-thalassemic stem cells The 14-3-3 protein may be a critical mediator of the signaling pathway that regulates between cell survival and death due to ... an effective caspase that is cleaved by caspase-3 after the activation of the caspase cascade [35] Caspase has an important role in the regulation of chromatin condensation through the cleavage...

Ngày tải lên: 18/06/2014, 19:20

10 425 0
báo cáo hóa học:" Elevated adipogenesis of marrow mesenchymal stem cells during early steroid-associated osteonecrosis development" pptx

báo cáo hóa học:" Elevated adipogenesis of marrow mesenchymal stem cells during early steroid-associated osteonecrosis development" pptx

... GAPDH mRNA was also amplified under the same conditions to normalize PPARγ2 mRNA expression (GAPDH forward 5'GCGGAGCCAAAAGGGT CATCAT3' and reverse 5' CAGCCC CAGCATCGAAGGTA GAGG3') PCR was performed ... Madison, USA) For PCR reaction, ml of each cDNA was subjected to PCR reaction using rabbit PPARγ2 primers (PPARγ2 forward 5'CCAGGGGCCGAGAAGGAGA3' and reverse 5'AAGCCAGGGATGTTTTTG 3') The internal control ... kept in cage and received a standard laboratory diet and had free access to food and water ad libitum All animal experiment procedures described below were reviewed and approved by the animal ethics...

Ngày tải lên: 20/06/2014, 00:20

7 351 0
o cáo hóa học:" Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/b-thalassemia" pptx

o cáo hóa học:" Phosphoproteomic analysis of apoptotic hematopoietic stem cells from hemoglobin E/b-thalassemia" pptx

... Jaresitthikunchai and Narumon Phaonakrop, BIOTEC, NSTDA for MS data interpretation and Decyder program tutorial Dr Samart Pakakasama, Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital Department ... isoforms sigma, gamma and zeta/delta in HbE/ b-thalassemic stem cells The 14-3-3 protein may be a critical mediator of the signaling pathway that regulates between cell survival and death due to ... an effective caspase that is cleaved by caspase-3 after the activation of the caspase cascade [35] Caspase has an important role in the regulation of chromatin condensation through the cleavage...

Ngày tải lên: 20/06/2014, 04:20

10 339 0
Báo cáo y học: "Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation" potx

Báo cáo y học: "Biology of adult mesenchymal stem cells: regulation of niche, self-renewal and differentiation" potx

... Kahata K, Hayashi M, Asaka M, Hellman U, Kitagawa H, Yanagisawa J, Kato S, Imamura T, Miyazono K: Regulation of transβ forming growth factor-β and bone morphogenetic protein signalling by transcriptional ... model by Jagged 1, a Notch ligand [57] Other animal cardiac and vascular injury models and human clinical trials are being actively investigated to explore the potential regeneration of cardiac tissue ... hematopoietic lineages, and Wnt 3a- specific maintenance of skin and intestinal stem cell populations [18] Because stem cells may share signaling mechanisms with cancer cells that arise from deregulated differentiation...

Ngày tải lên: 09/08/2014, 10:20

10 526 0
Báo cáo y học: "Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells" pdf

Báo cáo y học: "Chordin knockdown enhances the osteogenic differentiation of human mesenchymal stem cells" pdf

... candidate siRNAs Subsequently, the cells were transfected with chordin-specific siRNA and were cultured for days (for mRNA analysis), 10 days (for mRNA analysis and ALP assay), and 21 days (for ... UK) and images acquired and stored with a Genesnap software (Syngene, Cambridge, UK) Statistical analysis The data are expressed as mean ± standard deviation and were analyzed using the statistical ... Media of all cultures was changed every days Measurement of alkaline phosphatase activity and in vitro mineralisation Osteogenic differentiation of human MSCs was evaluated after 10 and 21 days...

Ngày tải lên: 09/08/2014, 10:23

9 404 0
Fibronectin and laminin promote differentiation of human mesenchymal stem cells into insulin producing cells through activating Akt and ERK pptx

Fibronectin and laminin promote differentiation of human mesenchymal stem cells into insulin producing cells through activating Akt and ERK pptx

... of Akt and ERK for stage III cells There was a baseline of Akt and ERK phosphorylation without adding ECM FN and LAM increased phosphorylation of Akt and ERK, and LAM had greater effects on Akt ... conception and design, and manuscript writing, SCH assisted with conception and design, data analysis and interpretation, and manuscript writing All authors read and approved the final manuscript Author ... data analysis and interpretation, and manuscript writing, LLC assisted with collection and assembly of data, data analysis and interpretation, SHC assisted with conception and design, YJW assisted...

Ngày tải lên: 10/08/2014, 05:21

10 332 0
w